ID: 976994842

View in Genome Browser
Species Human (GRCh38)
Location 4:91417783-91417805
Sequence ACATAGGTAAACATGTGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21467
Summary {0: 122, 1: 1423, 2: 5860, 3: 7876, 4: 6186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976994842_976994845 10 Left 976994842 4:91417783-91417805 CCGTGACACATGTTTACCTATGT 0: 122
1: 1423
2: 5860
3: 7876
4: 6186
Right 976994845 4:91417816-91417838 CACATTGTGCACGTGTACCCTGG 0: 4
1: 28
2: 152
3: 749
4: 1141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976994842 Original CRISPR ACATAGGTAAACATGTGTCA CGG (reversed) Intronic
Too many off-targets to display for this crispr