ID: 976994843

View in Genome Browser
Species Human (GRCh38)
Location 4:91417799-91417821
Sequence AATGTGCAGGTTTGTTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36432
Summary {0: 2219, 1: 7640, 2: 10932, 3: 9387, 4: 6254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976994843_976994845 -6 Left 976994843 4:91417799-91417821 CCTATGTAACAAACCTGCACATT 0: 2219
1: 7640
2: 10932
3: 9387
4: 6254
Right 976994845 4:91417816-91417838 CACATTGTGCACGTGTACCCTGG 0: 4
1: 28
2: 152
3: 749
4: 1141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976994843 Original CRISPR AATGTGCAGGTTTGTTACAT AGG (reversed) Intronic
Too many off-targets to display for this crispr