ID: 976994845

View in Genome Browser
Species Human (GRCh38)
Location 4:91417816-91417838
Sequence CACATTGTGCACGTGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2074
Summary {0: 4, 1: 28, 2: 152, 3: 749, 4: 1141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976994841_976994845 13 Left 976994841 4:91417780-91417802 CCACCGTGACACATGTTTACCTA 0: 9
1: 187
2: 1860
3: 6362
4: 10367
Right 976994845 4:91417816-91417838 CACATTGTGCACGTGTACCCTGG 0: 4
1: 28
2: 152
3: 749
4: 1141
976994843_976994845 -6 Left 976994843 4:91417799-91417821 CCTATGTAACAAACCTGCACATT 0: 2219
1: 7640
2: 10932
3: 9387
4: 6254
Right 976994845 4:91417816-91417838 CACATTGTGCACGTGTACCCTGG 0: 4
1: 28
2: 152
3: 749
4: 1141
976994842_976994845 10 Left 976994842 4:91417783-91417805 CCGTGACACATGTTTACCTATGT 0: 122
1: 1423
2: 5860
3: 7876
4: 6186
Right 976994845 4:91417816-91417838 CACATTGTGCACGTGTACCCTGG 0: 4
1: 28
2: 152
3: 749
4: 1141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976994845 Original CRISPR CACATTGTGCACGTGTACCC TGG Intronic
Too many off-targets to display for this crispr