ID: 976997552

View in Genome Browser
Species Human (GRCh38)
Location 4:91454427-91454449
Sequence CCTTATAAGTAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976997552_976997558 9 Left 976997552 4:91454427-91454449 CCCTCCACCTTCTACTTATAAGG 0: 1
1: 0
2: 3
3: 22
4: 246
Right 976997558 4:91454459-91454481 GATTACATTTAGGACCCACCTGG 0: 1
1: 12
2: 53
3: 146
4: 460
976997552_976997559 19 Left 976997552 4:91454427-91454449 CCCTCCACCTTCTACTTATAAGG 0: 1
1: 0
2: 3
3: 22
4: 246
Right 976997559 4:91454469-91454491 AGGACCCACCTGGATAATCCAGG 0: 6
1: 56
2: 246
3: 650
4: 1199
976997552_976997557 -1 Left 976997552 4:91454427-91454449 CCCTCCACCTTCTACTTATAAGG 0: 1
1: 0
2: 3
3: 22
4: 246
Right 976997557 4:91454449-91454471 GACACACACAGATTACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976997552 Original CRISPR CCTTATAAGTAGAAGGTGGA GGG (reversed) Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901197579 1:7448720-7448742 CCTTATAAAAAGAGGCTGGAGGG - Intronic
901197579 1:7448720-7448742 CCTTATAAAAAGAGGCTGGAGGG - Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902460229 1:16569381-16569403 CCTTCTAAATACAGGGTGGAGGG + Intronic
902460229 1:16569381-16569403 CCTTCTAAATACAGGGTGGAGGG + Intronic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
904712694 1:32442698-32442720 GTTTAAAAGTAGAAGGTGGCTGG + Intergenic
904712694 1:32442698-32442720 GTTTAAAAGTAGAAGGTGGCTGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
910111969 1:83692755-83692777 CCTTAAGGGTAGGAGGTGGAAGG - Intergenic
910111969 1:83692755-83692777 CCTTAAGGGTAGGAGGTGGAAGG - Intergenic
912198431 1:107427257-107427279 CCTTATAATTGGAGGGTGGAAGG + Intronic
912198431 1:107427257-107427279 CCTTATAATTGGAGGGTGGAAGG + Intronic
912522822 1:110257990-110258012 GATTATAAGTAGAACTTGGATGG - Intronic
912522822 1:110257990-110258012 GATTATAAGTAGAACTTGGATGG - Intronic
913605188 1:120459200-120459222 CCTTCTAAATACAGGGTGGAGGG - Intergenic
913605188 1:120459200-120459222 CCTTCTAAATACAGGGTGGAGGG - Intergenic
913642054 1:120821937-120821959 CCTTCTAAATACAGGGTGGAGGG - Intronic
913642054 1:120821937-120821959 CCTTCTAAATACAGGGTGGAGGG - Intronic
914083350 1:144430008-144430030 CCTTCTAAATACAGGGTGGAGGG + Intronic
914083350 1:144430008-144430030 CCTTCTAAATACAGGGTGGAGGG + Intronic
914276426 1:146128427-146128449 CCTTCTAAATACAGGGTGGAGGG + Intronic
914276426 1:146128427-146128449 CCTTCTAAATACAGGGTGGAGGG + Intronic
914366391 1:146982761-146982783 CCTTCTAAATACAGGGTGGAGGG - Intronic
914366391 1:146982761-146982783 CCTTCTAAATACAGGGTGGAGGG - Intronic
914486056 1:148110686-148110708 CCTTCTAAATACAGGGTGGAGGG + Intronic
914486056 1:148110686-148110708 CCTTCTAAATACAGGGTGGAGGG + Intronic
914537470 1:148579382-148579404 CCTTCTAAATACAGGGTGGAGGG + Intronic
914537470 1:148579382-148579404 CCTTCTAAATACAGGGTGGAGGG + Intronic
914586388 1:149065834-149065856 CCTTCTAAATACAGGGTGGAGGG + Intronic
914586388 1:149065834-149065856 CCTTCTAAATACAGGGTGGAGGG + Intronic
914628456 1:149485963-149485985 CCTTCTAAATACAGGGTGGAGGG - Intergenic
914628456 1:149485963-149485985 CCTTCTAAATACAGGGTGGAGGG - Intergenic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
918440437 1:184561271-184561293 CCTTAAAATTAGGAGGAGGAGGG - Intronic
918440437 1:184561271-184561293 CCTTAAAATTAGGAGGAGGAGGG - Intronic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
920165658 1:204033938-204033960 CCTTATAAGTAAAAAGAGGGAGG - Intergenic
920165658 1:204033938-204033960 CCTTATAAGTAAAAAGAGGGAGG - Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
923611825 1:235503100-235503122 CCTTATAAGTAGAAAGTATTCGG - Intronic
923611825 1:235503100-235503122 CCTTATAAGTAGAAAGTATTCGG - Intronic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066444820 10:35472470-35472492 CCTTCTAAGTTGAAGGTATAAGG - Intronic
1066444820 10:35472470-35472492 CCTTCTAAGTTGAAGGTATAAGG - Intronic
1067599596 10:47586200-47586222 CCTGATCAGTATATGGTGGACGG - Intergenic
1067599596 10:47586200-47586222 CCTGATCAGTATATGGTGGACGG - Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1070434016 10:76370839-76370861 CATTATAAGTTGAGGATGGAAGG + Intronic
1070434016 10:76370839-76370861 CATTATAAGTTGAGGATGGAAGG + Intronic
1070713378 10:78699868-78699890 CCTTAAAAGGAGAAGGTCCAAGG - Intergenic
1070713378 10:78699868-78699890 CCTTAAAAGGAGAAGGTCCAAGG - Intergenic
1071651122 10:87394084-87394106 CCTGATCAGTATATGGTGGACGG - Intergenic
1071651122 10:87394084-87394106 CCTGATCAGTATATGGTGGACGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1073083605 10:100874734-100874756 CCTTAGTAGTAGAGGGTGTAGGG - Intergenic
1073083605 10:100874734-100874756 CCTTAGTAGTAGAGGGTGTAGGG - Intergenic
1073305250 10:102498161-102498183 CCTTAAAACATGAAGGTGGATGG + Intronic
1073305250 10:102498161-102498183 CCTTAAAACATGAAGGTGGATGG + Intronic
1074026455 10:109640837-109640859 ACTTGTAAGTAGAAGCTGGCCGG - Intergenic
1074026455 10:109640837-109640859 ACTTGTAAGTAGAAGCTGGCCGG - Intergenic
1074957290 10:118404624-118404646 CTTGATAAATGGAAGGTGGAGGG + Intergenic
1074957290 10:118404624-118404646 CTTGATAAATGGAAGGTGGAGGG + Intergenic
1077743911 11:4879715-4879737 ACTTATGCGTAGAAGGTAGATGG + Intronic
1077743911 11:4879715-4879737 ACTTATGCGTAGAAGGTAGATGG + Intronic
1079068362 11:17319189-17319211 TGATATAAGTAGAAGGTCGAGGG - Intronic
1079068362 11:17319189-17319211 TGATATAAGTAGAAGGTCGAGGG - Intronic
1079281411 11:19090185-19090207 CATTAAAAGTAGGAGGTAGAAGG + Intergenic
1079281411 11:19090185-19090207 CATTAAAAGTAGGAGGTAGAAGG + Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1084404287 11:68962038-68962060 CCTTATAAGGGGAAGCAGGAGGG + Intergenic
1084404287 11:68962038-68962060 CCTTATAAGGGGAAGCAGGAGGG + Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1085251614 11:75147753-75147775 CCTCAGAAGTCGGAGGTGGAAGG - Intronic
1085251614 11:75147753-75147775 CCTCAGAAGTCGGAGGTGGAAGG - Intronic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087418434 11:97888668-97888690 GCTTTTAGGTAGAAGGGGGAAGG - Intergenic
1087418434 11:97888668-97888690 GCTTTTAGGTAGAAGGGGGAAGG - Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092850685 12:12623858-12623880 CCTTATAAGACTAAGGTAGAGGG + Intronic
1092850685 12:12623858-12623880 CCTTATAAGACTAAGGTAGAGGG + Intronic
1093287061 12:17276906-17276928 CATTATAAGGAAAAGGTGAAGGG - Intergenic
1093287061 12:17276906-17276928 CATTATAAGGAAAAGGTGAAGGG - Intergenic
1093749161 12:22779027-22779049 CCTTACAAGGAGTAGGTGCAAGG - Intergenic
1093749161 12:22779027-22779049 CCTTACAAGGAGTAGGTGCAAGG - Intergenic
1094574692 12:31674469-31674491 CCTTAAAAGTAGAAGGAGAGAGG - Intronic
1094574692 12:31674469-31674491 CCTTAAAAGTAGAAGGAGAGAGG - Intronic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1096945820 12:55408844-55408866 GCTTTTAGGTAGAAAGTGGAAGG + Intergenic
1096945820 12:55408844-55408866 GCTTTTAGGTAGAAAGTGGAAGG + Intergenic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1100432146 12:94540558-94540580 CCTCATAACAAGAAGGTGCAGGG - Intergenic
1100432146 12:94540558-94540580 CCTCATAACAAGAAGGTGCAGGG - Intergenic
1100784635 12:98065910-98065932 CCTTATAAGTAAAAGTAGGAAGG + Intergenic
1100784635 12:98065910-98065932 CCTTATAAGTAAAAGTAGGAAGG + Intergenic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1104204841 12:126628847-126628869 CCTTAAAAGTAGAAGAGGAAGGG - Intergenic
1104204841 12:126628847-126628869 CCTTAAAAGTAGAAGAGGAAGGG - Intergenic
1106074336 13:26444586-26444608 CCTTATAAGAGAGAGGTGGAAGG + Intergenic
1106074336 13:26444586-26444608 CCTTATAAGAGAGAGGTGGAAGG + Intergenic
1107778687 13:43875955-43875977 CCTTATAAGAGAAAGGTAGAGGG + Intronic
1107778687 13:43875955-43875977 CCTTATAAGAGAAAGGTAGAGGG + Intronic
1108546545 13:51501024-51501046 CCTCCTAAGTTGCAGGTGGAGGG + Intergenic
1108546545 13:51501024-51501046 CCTCCTAAGTTGCAGGTGGAGGG + Intergenic
1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG + Intergenic
1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG + Intergenic
1112408570 13:99142452-99142474 ACTTCTAAGTGGGAGGTGGAAGG + Intergenic
1112408570 13:99142452-99142474 ACTTCTAAGTGGGAGGTGGAAGG + Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113166825 13:107452104-107452126 CCATAAAAGTGGAAGGAGGAGGG - Intronic
1113166825 13:107452104-107452126 CCATAAAAGTGGAAGGAGGAGGG - Intronic
1113792622 13:113037262-113037284 CCCTAGGAGTAGAAGGTGGAGGG + Intronic
1113792622 13:113037262-113037284 CCCTAGGAGTAGAAGGTGGAGGG + Intronic
1115286060 14:31713592-31713614 CCTTTTAAGTGGCATGTGGATGG + Intronic
1115286060 14:31713592-31713614 CCTTTTAAGTGGCATGTGGATGG + Intronic
1115763580 14:36600076-36600098 TATAATAAGTAGAAGCTGGATGG + Intergenic
1115763580 14:36600076-36600098 TATAATAAGTAGAAGCTGGATGG + Intergenic
1118662715 14:68031928-68031950 CCTTCTAAGGTGAATGTGGATGG - Intronic
1118662715 14:68031928-68031950 CCTTCTAAGGTGAATGTGGATGG - Intronic
1120194047 14:81463876-81463898 CCTTATATGGGAAAGGTGGAGGG - Intergenic
1120194047 14:81463876-81463898 CCTTATATGGGAAAGGTGGAGGG - Intergenic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1128878859 15:71224806-71224828 CCTTATAAGTGGGAGGTAGGAGG - Intronic
1128878859 15:71224806-71224828 CCTTATAAGTGGGAGGTAGGAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130510315 15:84583504-84583526 CCTTATAAGTGGATGGGGAAAGG - Intergenic
1130510315 15:84583504-84583526 CCTTATAAGTGGATGGGGAAAGG - Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1132115848 15:99135994-99136016 CCTTATAAGTGCAAATTGGAGGG + Intergenic
1132115848 15:99135994-99136016 CCTTATAAGTGCAAATTGGAGGG + Intergenic
1132271483 15:100530301-100530323 TCCTATAGGTAGAAGGTGGCTGG - Intronic
1132271483 15:100530301-100530323 TCCTATAGGTAGAAGGTGGCTGG - Intronic
1134308480 16:13054937-13054959 CCATATAAGTAGAAATTTGAAGG - Intronic
1134308480 16:13054937-13054959 CCATATAAGTAGAAATTTGAAGG - Intronic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1137952380 16:52795940-52795962 CCTTAAAAGTGGAAGAAGGAAGG + Intergenic
1137952380 16:52795940-52795962 CCTTAAAAGTGGAAGAAGGAAGG + Intergenic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1139307773 16:66002283-66002305 CCTTCCTAATAGAAGGTGGAAGG + Intergenic
1139307773 16:66002283-66002305 CCTTCCTAATAGAAGGTGGAAGG + Intergenic
1140172001 16:72615488-72615510 CCTTATAAGTTCTAGGGGGAGGG - Intergenic
1140172001 16:72615488-72615510 CCTTATAAGTTCTAGGGGGAGGG - Intergenic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1147020498 17:37528321-37528343 CCTTATAAGGGGAAGGTAGGAGG - Intronic
1147020498 17:37528321-37528343 CCTTATAAGGGGAAGGTAGGAGG - Intronic
1148481427 17:47961942-47961964 CCTTATAAGAGAGAGGTGGAGGG - Intergenic
1148481427 17:47961942-47961964 CCTTATAAGAGAGAGGTGGAGGG - Intergenic
1149909893 17:60557571-60557593 ACTGATAGGTAGAAGGTGGTGGG - Intergenic
1149909893 17:60557571-60557593 ACTGATAGGTAGAAGGTGGTGGG - Intergenic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG + Intronic
1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG + Intronic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156633121 18:38994523-38994545 GCTTATAAGTATTAGATGGAAGG - Intergenic
1156633121 18:38994523-38994545 GCTTATAAGTATTAGATGGAAGG - Intergenic
1158405915 18:57158968-57158990 CCTTAAAAGTAGAAATTGGGAGG - Intergenic
1158405915 18:57158968-57158990 CCTTAAAAGTAGAAATTGGGAGG - Intergenic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1161607778 19:5224368-5224390 CCTTATTAATGGAAGGAGGAGGG - Intronic
1161607778 19:5224368-5224390 CCTTATTAATGGAAGGAGGAGGG - Intronic
1162852322 19:13440318-13440340 ACTAATAAGTTGAAGGTGAAAGG - Intronic
1162852322 19:13440318-13440340 ACTAATAAGTTGAAGGTGAAAGG - Intronic
1163852952 19:19676521-19676543 CCTTCTGAATAGCAGGTGGATGG - Intronic
1163852952 19:19676521-19676543 CCTTCTGAATAGCAGGTGGATGG - Intronic
1164047946 19:21558900-21558922 CCTTATACCTAGAAGTTAGATGG - Intergenic
1164047946 19:21558900-21558922 CCTTATACCTAGAAGTTAGATGG - Intergenic
1164054772 19:21613333-21613355 ACTTATAAGTAGGAGTTGAATGG - Intergenic
1164054772 19:21613333-21613355 ACTTATAAGTAGGAGTTGAATGG - Intergenic
1164811386 19:31159299-31159321 CCTTAAAAGTAGAAGAGGGATGG - Intergenic
1164811386 19:31159299-31159321 CCTTAAAAGTAGAAGAGGGATGG - Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1167717336 19:51152247-51152269 CCTTACAAGTGAAAGGAGGAGGG - Intronic
1167717336 19:51152247-51152269 CCTTACAAGTGAAAGGAGGAGGG - Intronic
1202676661 1_KI270711v1_random:13109-13131 CCTTCTAAATACAGGGTGGAGGG + Intergenic
1202676661 1_KI270711v1_random:13109-13131 CCTTCTAAATACAGGGTGGAGGG + Intergenic
928657279 2:33465399-33465421 ACATAAAAGTACAAGGTGGAAGG + Intronic
928657279 2:33465399-33465421 ACATAAAAGTACAAGGTGGAAGG + Intronic
928681070 2:33702653-33702675 ACTTATAATAGGAAGGTGGAGGG - Intergenic
928681070 2:33702653-33702675 ACTTATAATAGGAAGGTGGAGGG - Intergenic
928846381 2:35678366-35678388 ACTTATAAGAGAAAGGTGGAAGG - Intergenic
928846381 2:35678366-35678388 ACTTATAAGAGAAAGGTGGAAGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
930418599 2:51120964-51120986 GGTTATAAGTAGAAGATGGTAGG - Intergenic
930418599 2:51120964-51120986 GGTTATAAGTAGAAGATGGTAGG - Intergenic
931685340 2:64787482-64787504 CCTTATAAGACTAAAGTGGAGGG + Intergenic
931685340 2:64787482-64787504 CCTTATAAGACTAAAGTGGAGGG + Intergenic
931685468 2:64788559-64788581 CCTTATAAGATAAAAGTGGAGGG + Intergenic
931685468 2:64788559-64788581 CCTTATAAGATAAAAGTGGAGGG + Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
937839213 2:126508790-126508812 ACTTACAAGTAGAAAGTGGCAGG + Intergenic
937839213 2:126508790-126508812 ACTTACAAGTAGAAAGTGGCAGG + Intergenic
939629224 2:144514384-144514406 TCGTATAAGTAGAAGCTGGAAGG - Intronic
939629224 2:144514384-144514406 TCGTATAAGTAGAAGCTGGAAGG - Intronic
939683314 2:145166501-145166523 CCTTAGAAAGAGGAGGTGGAGGG - Intergenic
939683314 2:145166501-145166523 CCTTAGAAAGAGGAGGTGGAGGG - Intergenic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940541817 2:155029946-155029968 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
940541817 2:155029946-155029968 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG + Intergenic
940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG + Intergenic
940690329 2:156909886-156909908 TCTTAGAAGTAGAAGACGGAAGG + Intergenic
940690329 2:156909886-156909908 TCTTAGAAGTAGAAGACGGAAGG + Intergenic
940863146 2:158790578-158790600 GCTAAGAAGTCGAAGGTGGAGGG - Intergenic
940863146 2:158790578-158790600 GCTAAGAAGTCGAAGGTGGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
943400109 2:187398100-187398122 CCCAATTAGTAAAAGGTGGAAGG + Intronic
943400109 2:187398100-187398122 CCCAATTAGTAAAAGGTGGAAGG + Intronic
944215460 2:197250316-197250338 CCTTATAAGAAACAGGTGCAGGG - Intronic
944215460 2:197250316-197250338 CCTTATAAGAAACAGGTGCAGGG - Intronic
944741322 2:202615561-202615583 CCTTTTAAGTTAAAGATGGAGGG + Intergenic
944741322 2:202615561-202615583 CCTTTTAAGTTAAAGATGGAGGG + Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945599685 2:211845113-211845135 CTTTATGAGTAACAGGTGGAAGG + Intronic
945599685 2:211845113-211845135 CTTTATGAGTAACAGGTGGAAGG + Intronic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946878273 2:224151814-224151836 CCTTATAAGTAAGAGAGGGAGGG + Intergenic
946878273 2:224151814-224151836 CCTTATAAGTAAGAGAGGGAGGG + Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169557338 20:6765424-6765446 CATTCTAAGTTGCAGGTGGAAGG + Intergenic
1169557338 20:6765424-6765446 CATTCTAAGTTGCAGGTGGAAGG + Intergenic
1169883107 20:10368603-10368625 CCTTCTAAGTAGGAGGTAAATGG - Intergenic
1169883107 20:10368603-10368625 CCTTCTAAGTAGGAGGTAAATGG - Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1175830410 20:61962264-61962286 CCTGATAAGGGGAAGGCGGATGG + Intronic
1175830410 20:61962264-61962286 CCTGATAAGGGGAAGGCGGATGG + Intronic
1177743289 21:25179558-25179580 ACTTATAAGTAAAAGTTGAAAGG - Intergenic
1177743289 21:25179558-25179580 ACTTATAAGTAAAAGTTGAAAGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178952666 21:36998058-36998080 CCTCATAAGAAAAAGGCGGAAGG - Intergenic
1178952666 21:36998058-36998080 CCTCATAAGAAAAAGGCGGAAGG - Intergenic
1179285610 21:39975130-39975152 CCCTATAAGAGGAGGGTGGAGGG - Intergenic
1179285610 21:39975130-39975152 CCCTATAAGAGGAGGGTGGAGGG - Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
952804104 3:37330503-37330525 CCTTTTAGGTAGAAGGGTGAGGG + Intronic
952804104 3:37330503-37330525 CCTTTTAGGTAGAAGGGTGAGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
959010889 3:101074629-101074651 TCTTATAAGTAAAAGGCAGAGGG + Intergenic
959010889 3:101074629-101074651 TCTTATAAGTAAAAGGCAGAGGG + Intergenic
964562801 3:158016831-158016853 CCTTATAGGTTAAAGATGGAAGG - Intergenic
964562801 3:158016831-158016853 CCTTATAGGTTAAAGATGGAAGG - Intergenic
964928713 3:161988991-161989013 CATTATAAGTGGAAGGCAGAAGG - Intergenic
964928713 3:161988991-161989013 CATTATAAGTGGAAGGCAGAAGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
965858871 3:173123096-173123118 CGTTATTATTAGAAGGTAGAGGG + Intronic
965858871 3:173123096-173123118 CGTTATTATTAGAAGGTAGAGGG + Intronic
967147517 3:186618538-186618560 CCACATAGGTAGAAGGTGGGAGG - Exonic
967147517 3:186618538-186618560 CCACATAGGTAGAAGGTGGGAGG - Exonic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
969939716 4:10718875-10718897 TATTATAAATGGAAGGTGGAAGG + Intergenic
969939716 4:10718875-10718897 TATTATAAATGGAAGGTGGAAGG + Intergenic
972279322 4:37587191-37587213 GCTTATGAGAAGGAGGTGGAGGG - Intronic
972279322 4:37587191-37587213 GCTTATGAGAAGGAGGTGGAGGG - Intronic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
976396050 4:84556938-84556960 ACTTATAAGTGGGAGGTGAATGG + Intergenic
976396050 4:84556938-84556960 ACTTATAAGTGGGAGGTGAATGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977027804 4:91842534-91842556 CCTTATAAGTGGGAGCTGGAAGG + Intergenic
977027804 4:91842534-91842556 CCTTATAAGTGGGAGCTGGAAGG + Intergenic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
980802576 4:137770677-137770699 CCCTATAAATATAAGGTGGAAGG + Intergenic
980802576 4:137770677-137770699 CCCTATAAATATAAGGTGGAAGG + Intergenic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
984257684 4:177407792-177407814 ACTTTAAAATAGAAGGTGGAGGG + Intergenic
984257684 4:177407792-177407814 ACTTTAAAATAGAAGGTGGAGGG + Intergenic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
985750518 5:1671392-1671414 CCTCATAGGTTGAAGTTGGAGGG + Intergenic
985750518 5:1671392-1671414 CCTCATAGGTTGAAGTTGGAGGG + Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
986675048 5:10176861-10176883 CCCTAAATGTGGAAGGTGGAGGG + Intergenic
986675048 5:10176861-10176883 CCCTAAATGTGGAAGGTGGAGGG + Intergenic
987597201 5:20017301-20017323 TCTTATAAATAGAATTTGGAAGG - Intronic
987597201 5:20017301-20017323 TCTTATAAATAGAATTTGGAAGG - Intronic
989384023 5:40836854-40836876 CCTTAAAAGTAGGAGAAGGATGG - Intergenic
989384023 5:40836854-40836876 CCTTAAAAGTAGGAGAAGGATGG - Intergenic
990412487 5:55554655-55554677 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
990412487 5:55554655-55554677 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
990716433 5:58642466-58642488 CCTTGTAGGTAGAATGTGGTTGG - Intronic
990716433 5:58642466-58642488 CCTTGTAGGTAGAATGTGGTTGG - Intronic
991893624 5:71366660-71366682 CCTTATAACTAGAAGGTATCTGG + Intergenic
991893624 5:71366660-71366682 CCTTATAACTAGAAGGTATCTGG + Intergenic
992806797 5:80345638-80345660 CCTTGGAAGTCCAAGGTGGAAGG + Intergenic
992806797 5:80345638-80345660 CCTTGGAAGTCCAAGGTGGAAGG + Intergenic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
996961292 5:129253435-129253457 CCTTATAAATGGAAGCTGAACGG - Intergenic
996961292 5:129253435-129253457 CCTTATAAATGGAAGCTGAACGG - Intergenic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000658202 5:163907478-163907500 ACTTATAAGTGGAAGGTAAATGG - Intergenic
1000658202 5:163907478-163907500 ACTTATAAGTGGAAGGTAAATGG - Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1001858166 5:175030824-175030846 CCTAAAAGGTAGATGGTGGAAGG + Intergenic
1001858166 5:175030824-175030846 CCTAAAAGGTAGATGGTGGAAGG + Intergenic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1005369053 6:25111241-25111263 CCAAATAAGTAGAATCTGGAAGG + Intergenic
1005369053 6:25111241-25111263 CCAAATAAGTAGAATCTGGAAGG + Intergenic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1009868559 6:69428573-69428595 CCCTATAACTAGAAGGAAGAAGG + Intergenic
1009868559 6:69428573-69428595 CCCTATAACTAGAAGGAAGAAGG + Intergenic
1011163429 6:84418889-84418911 CCTTAAAAGTGGAAGATAGAGGG - Intergenic
1011163429 6:84418889-84418911 CCTTAAAAGTGGAAGATAGAGGG - Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011757256 6:90512847-90512869 ACTTATAACTAGAAGATGCAGGG - Intergenic
1011757256 6:90512847-90512869 ACTTATAACTAGAAGATGCAGGG - Intergenic
1013358253 6:109366344-109366366 CCTTGGAAGTAATAGGTGGAGGG - Intergenic
1013358253 6:109366344-109366366 CCTTGGAAGTAATAGGTGGAGGG - Intergenic
1014405637 6:121047145-121047167 CCTTTTAAGTAGAAAGGGGCAGG + Intergenic
1014405637 6:121047145-121047167 CCTTTTAAGTAGAAAGGGGCAGG + Intergenic
1015154896 6:130081889-130081911 CCTAATTAATAGAAGCTGGAGGG - Intronic
1015154896 6:130081889-130081911 CCTAATTAATAGAAGCTGGAGGG - Intronic
1015196198 6:130526955-130526977 TCATATAGGTTGAAGGTGGAAGG + Intergenic
1015196198 6:130526955-130526977 TCATATAGGTTGAAGGTGGAAGG + Intergenic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1022034328 7:26519342-26519364 GCTTTTAAGAAGAAGTTGGAGGG - Intergenic
1022034328 7:26519342-26519364 GCTTTTAAGAAGAAGTTGGAGGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023195722 7:37636561-37636583 ACTTATAAGTGGAAGCTGAATGG - Intergenic
1023195722 7:37636561-37636583 ACTTATAAGTGGAAGCTGAATGG - Intergenic
1027545071 7:79517365-79517387 CCTTATATCAAGAAGGTGAAGGG - Intergenic
1027545071 7:79517365-79517387 CCTTATATCAAGAAGGTGAAGGG - Intergenic
1027887589 7:83929343-83929365 TATTATAAGTAGAAGGTAGGTGG - Intergenic
1027887589 7:83929343-83929365 TATTATAAGTAGAAGGTAGGTGG - Intergenic
1029183339 7:98720455-98720477 CCTTATAAGTAGGAGACGGAGGG - Intergenic
1029183339 7:98720455-98720477 CCTTATAAGTAGGAGACGGAGGG - Intergenic
1029794461 7:102879380-102879402 TCTTATAGGTGGAAGGTTGATGG - Intronic
1029794461 7:102879380-102879402 TCTTATAGGTGGAAGGTTGATGG - Intronic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1034237248 7:149581945-149581967 CCTTATTAGTATAAGATGTATGG + Intergenic
1034237248 7:149581945-149581967 CCTTATTAGTATAAGATGTATGG + Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037972126 8:23179800-23179822 TCTTAAAAGTAGAAGATGGCCGG - Intergenic
1037972126 8:23179800-23179822 TCTTAAAAGTAGAAGATGGCCGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1044324281 8:90842271-90842293 CCTTTGAGGTTGAAGGTGGATGG - Intronic
1044324281 8:90842271-90842293 CCTTTGAGGTTGAAGGTGGATGG - Intronic
1044429512 8:92092191-92092213 CCTTATAACAAGAAAGTGAATGG - Intronic
1044429512 8:92092191-92092213 CCTTATAACAAGAAAGTGAATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1047624884 8:126646561-126646583 CATGTTAAGTAGAAGATGGACGG + Intergenic
1047624884 8:126646561-126646583 CATGTTAAGTAGAAGATGGACGG + Intergenic
1048285546 8:133138442-133138464 CCTTAAAAGTAGAAGAGGGAGGG + Intergenic
1048285546 8:133138442-133138464 CCTTAAAAGTAGAAGAGGGAGGG + Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048606126 8:135970716-135970738 CCTTGTAAGTGAAAGGGGGAAGG + Intergenic
1048606126 8:135970716-135970738 CCTTGTAAGTGAAAGGGGGAAGG + Intergenic
1048722808 8:137346055-137346077 TCTTATAAGTGGAAGATAGAAGG - Intergenic
1048722808 8:137346055-137346077 TCTTATAAGTGGAAGATAGAAGG - Intergenic
1050685649 9:8165607-8165629 CCTTATAAAGAAAAGGTAGATGG - Intergenic
1050685649 9:8165607-8165629 CCTTATAAAGAAAAGGTAGATGG - Intergenic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1189634068 X:42986249-42986271 ACTTATAAGTAGAAGCTAAAGGG + Intergenic
1189634068 X:42986249-42986271 ACTTATAAGTAGAAGCTAAAGGG + Intergenic
1189887814 X:45566875-45566897 CCATAGAAATAGAAGGTAGAAGG + Intergenic
1189887814 X:45566875-45566897 CCATAGAAATAGAAGGTAGAAGG + Intergenic
1190033408 X:46996702-46996724 CCTTACAAGAGAAAGGTGGAGGG - Intronic
1190033408 X:46996702-46996724 CCTTACAAGAGAAAGGTGGAGGG - Intronic
1190057009 X:47186896-47186918 CCTTATCAGGCCAAGGTGGATGG + Intergenic
1190057009 X:47186896-47186918 CCTTATCAGGCCAAGGTGGATGG + Intergenic
1194355924 X:92883856-92883878 CCTTATAAGTGGAAGCTAAATGG + Intergenic
1194355924 X:92883856-92883878 CCTTATAAGTGGAAGCTAAATGG + Intergenic
1195443541 X:104923887-104923909 TCTTATAGGTAGCAGGTGGTTGG - Intronic
1195443541 X:104923887-104923909 TCTTATAGGTAGCAGGTGGTTGG - Intronic
1197498017 X:127209686-127209708 CCTTAAAAGTGGAAGATGAAGGG - Intergenic
1197498017 X:127209686-127209708 CCTTAAAAGTGGAAGATGAAGGG - Intergenic
1198105601 X:133458397-133458419 CCTTATAAGAGAAAGGCGGAGGG - Intergenic
1198105601 X:133458397-133458419 CCTTATAAGAGAAAGGCGGAGGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199923198 X:152431692-152431714 CCTTAAAAGTGGAAGTGGGAGGG + Intronic
1199923198 X:152431692-152431714 CCTTAAAAGTGGAAGTGGGAGGG + Intronic