ID: 976998824

View in Genome Browser
Species Human (GRCh38)
Location 4:91469099-91469121
Sequence CTAATATACCAAATCTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976998824 Original CRISPR CTAATATACCAAATCTACAT TGG Intronic
900008648 1:85835-85857 ATTATATACAAAATCTAGATTGG + Intergenic
900036882 1:419846-419868 ATTATATACAAAATCTAGATTGG + Intergenic
900058509 1:655585-655607 ATTATATACAAAATCTAGATTGG + Intergenic
907572354 1:55494942-55494964 CTAATATCCAGAATCTACAATGG - Intergenic
908489557 1:64629693-64629715 CTAATATGCCAAATATAAAAAGG + Intronic
908681856 1:66670723-66670745 TTAATTTACCAAATCTACCCAGG + Intronic
910361711 1:86419020-86419042 CTAATATATGAAATATATATTGG - Intergenic
910575478 1:88758408-88758430 CTTATATAACAAATCTTCACAGG - Intronic
911781765 1:101888763-101888785 CTAATATCCAGAATCTACAAAGG + Intronic
912434462 1:109650836-109650858 CAACTATACTAAATCAACATTGG + Intergenic
912613912 1:111078156-111078178 TGAAAAGACCAAATCTACATCGG - Intergenic
913125200 1:115780619-115780641 CTAATATCCAGAATCTACAAAGG + Intergenic
915670093 1:157481648-157481670 CTAATATCCCTAATCCTCATTGG + Intergenic
915756933 1:158270760-158270782 CTAGTATCCAGAATCTACATGGG + Intergenic
917744154 1:177991296-177991318 CTAATATCCAGAATCTACAAAGG + Intergenic
917985592 1:180314804-180314826 CTGATATACCAAAGTTCCATAGG + Intronic
918565965 1:185932320-185932342 CAAATATACCAAAACCACAGTGG - Intronic
919274076 1:195389851-195389873 CTAACATACAGAATCAACATAGG - Intergenic
923431234 1:233922525-233922547 CTAATATCCAGAATCTACAAAGG - Intronic
924149938 1:241119422-241119444 CTACTATACCAAAACTCCACAGG + Intronic
924487508 1:244500222-244500244 CTAATATCCAGAATCTACAAGGG - Intronic
924950815 1:248881478-248881500 GGAATATACCAACTTTACATGGG - Intergenic
1064763153 10:18642933-18642955 CTAATATACACAATCAACACTGG + Intronic
1064968467 10:21039103-21039125 CTAATATCCAGAATCTACAAGGG - Intronic
1065364272 10:24919745-24919767 CTAATATCCAGAATCTACAAGGG + Intronic
1065691863 10:28342398-28342420 CTAATATCCAGCATCTACATTGG - Intergenic
1065990077 10:31000479-31000501 CTCTGATACCAAGTCTACATAGG + Intronic
1068079040 10:52295604-52295626 TTAATATACCAAATTCACACAGG - Exonic
1068505650 10:57896368-57896390 CTAATATCCAGAATCTACAGTGG + Intergenic
1068518227 10:58050300-58050322 CTAACATAGCAAATTTGCATTGG + Intergenic
1068889591 10:62134931-62134953 CTAATATCCAGAATCTACAAGGG - Intergenic
1074322686 10:112417767-112417789 CTATTATACCCACTCTACAGTGG + Intronic
1076499668 10:130927689-130927711 CTAATAATCCAAATTTCCATAGG - Intergenic
1076929055 10:133515906-133515928 CTAAGGAACCAAATCTTCATTGG - Intergenic
1077693651 11:4373130-4373152 CCAAGATATCAAATCAACATAGG - Intergenic
1078293114 11:10035527-10035549 CTAATATCCAGAATCTACAAAGG + Intronic
1079712203 11:23699649-23699671 CTAATATCCAGAATCTACAAGGG + Intergenic
1079894928 11:26106551-26106573 TTAATAAAAAAAATCTACATGGG - Intergenic
1080482133 11:32662565-32662587 CTAATATCCAGAATCTACAAAGG - Intronic
1081423231 11:42897084-42897106 CTAATATCCAGAATCTACAATGG - Intergenic
1082141641 11:48616397-48616419 TGAAAAGACCAAATCTACATTGG - Intergenic
1082687915 11:56261967-56261989 CTAATATCCAAAATCTACAAGGG + Intergenic
1082883120 11:58057919-58057941 TTATTATACTCAATCTACATAGG + Intronic
1086284379 11:85229255-85229277 CTAATATCCAGAATCTACAAAGG + Intronic
1087555753 11:99718785-99718807 CTAAAATACCACAGCTAAATAGG + Intronic
1087691753 11:101328590-101328612 TTATTATTCCCAATCTACATAGG + Intergenic
1087753654 11:102032298-102032320 CTAATATCCAGAATCTACAAAGG - Intergenic
1088637785 11:111840749-111840771 ATTATAAACCAAATATACATTGG + Exonic
1089230201 11:116967373-116967395 CCAATATAATAAATCTCCATAGG - Intronic
1090933183 11:131317777-131317799 CTAATATCCAGAATCTACAAAGG + Intergenic
1091265480 11:134267879-134267901 CTAATTTATCAAATCTATAAAGG - Intergenic
1093579842 12:20774206-20774228 CTAATATCCAGAATCTACAATGG + Intergenic
1093630314 12:21400139-21400161 CTAATATCCAGAATCTACAATGG + Intronic
1093988323 12:25562777-25562799 TGAAAAGACCAAATCTACATCGG - Intronic
1094132717 12:27092162-27092184 TGAAAAGACCAAATCTACATCGG + Intergenic
1095531616 12:43193162-43193184 CTAATATCCAGAATCTACAACGG - Intergenic
1095720689 12:45397107-45397129 CTAATATCCAGAATCTACAAGGG + Intronic
1096895089 12:54813449-54813471 CTAATATCCAGAATCTACAATGG - Intergenic
1097524061 12:60708108-60708130 CTAATAACCAAAATCTACAAAGG - Intergenic
1097838538 12:64298258-64298280 CTAATATCCAGAATCTACAAAGG - Intronic
1097852858 12:64430559-64430581 TTAATATACCAAATATATATTGG + Intronic
1098221904 12:68278987-68279009 GTCATATACCAAATCCCCATAGG - Intronic
1099428151 12:82549825-82549847 TGAAAAGACCAAATCTACATTGG - Intergenic
1100487937 12:95049278-95049300 ATAAAATAACAATTCTACATAGG + Intronic
1101118875 12:101558358-101558380 CTAATATCCAGAATCTACAAAGG + Intergenic
1101628135 12:106466331-106466353 CTAATATCCAGAATCTACAACGG - Intronic
1103167750 12:118784809-118784831 CTAATACACCAGATCTAAAGGGG + Intergenic
1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG + Intergenic
1105524162 13:21159961-21159983 CGAATATACCAACTCTCCTTTGG - Exonic
1105998047 13:25691867-25691889 CAAATATAGCAAATCCACTTTGG - Intronic
1106244488 13:27936845-27936867 CTAATATCCAGAATCTACAAAGG + Intergenic
1106386028 13:29287033-29287055 CTAATATACAGAATCTAATTTGG + Intronic
1107618829 13:42202863-42202885 ATAATATACGTAATTTACATGGG + Intronic
1109816349 13:67589859-67589881 CTAAAAGACCAAATGTACGTTGG + Intergenic
1110505026 13:76275726-76275748 CTAATATCCAGAATCTACAAGGG + Intergenic
1111024876 13:82507918-82507940 CTTATAAAGCATATCTACATAGG - Intergenic
1112012415 13:95303175-95303197 CTATTTTAGCAAATATACATGGG - Intergenic
1112872200 13:103987022-103987044 CAAATATTTCAAATATACATCGG + Intergenic
1114011432 14:18373288-18373310 CTAATATCCAGAATCTACAAAGG + Intergenic
1114665419 14:24374733-24374755 CTCATATACCCTATCTACATGGG - Intronic
1116416162 14:44679964-44679986 CTATTTTATAAAATCTACATTGG - Intergenic
1117630060 14:57681761-57681783 CTAATATCCAGAATCTACAAAGG + Intronic
1117651430 14:57910178-57910200 CTGATATACAAAATATACAAAGG - Intronic
1119891741 14:78187910-78187932 CAAATTTCCCAACTCTACATAGG - Intergenic
1121455146 14:94033825-94033847 CTAATACAGCAAATATTCATAGG - Intronic
1123218350 14:106832846-106832868 CTAATATAACATATGTATATAGG + Intergenic
1125167881 15:36730390-36730412 TTAAAATACCAAATCTTCACAGG - Intronic
1125865183 15:43040707-43040729 CTAATATCCAGAATCTACAAAGG + Intronic
1126856336 15:52843010-52843032 CTAATATCCAGAATCTACAAAGG + Intergenic
1127074843 15:55315520-55315542 CTAATATCCAGAATCTACAAGGG + Intronic
1127317372 15:57810019-57810041 CTAATATCCAGAATCTACAAAGG - Intergenic
1127491631 15:59470344-59470366 TGAAAAGACCAAATCTACATTGG - Intronic
1127897316 15:63313072-63313094 TTAATTTACCTAATCTAGATCGG + Intergenic
1130223576 15:82041670-82041692 ATAATATACAAAATGTACCTGGG + Intergenic
1131028843 15:89169185-89169207 CTTATATCACAAATCTACTTAGG - Intronic
1133695322 16:8257562-8257584 CCAACATTTCAAATCTACATGGG + Intergenic
1138906238 16:61338363-61338385 CTAATATCCAAAATCTATAAGGG + Intergenic
1140574283 16:76147285-76147307 CTAATATTCCATATTTACAAAGG - Intergenic
1141513528 16:84527711-84527733 TTAAGATAACAAATCCACATTGG - Intronic
1143613153 17:8032088-8032110 CTAATAAAACAAATATACACAGG + Intergenic
1145396641 17:22501590-22501612 TGAAAAGACCAAATCTACATTGG - Intergenic
1145733108 17:27208329-27208351 CTAATATCCAGAATCTACAAAGG + Intergenic
1148918640 17:51007663-51007685 CTAATATTCCAACACTACATAGG + Intronic
1149168615 17:53782959-53782981 CTAATATCCAGAATCTACAAAGG + Intergenic
1149168717 17:53784043-53784065 CTAATATCCAGAATCTACAAAGG + Intergenic
1152902900 17:82955237-82955259 CTAATATACAGGATCTACAAGGG + Intronic
1153506561 18:5805246-5805268 CTAATACAACAAATATTCATAGG + Intergenic
1155102094 18:22621482-22621504 CTAATATCCAGAATCTACAAAGG + Intergenic
1155459228 18:26057780-26057802 CTAATATACGAAAGATGCATAGG + Intronic
1155635168 18:27944478-27944500 CTAATATATCAAATATATGTTGG + Intergenic
1156769556 18:40702629-40702651 CTAATATCCATAATCTACAAGGG + Intergenic
1158413479 18:57229115-57229137 CTAATATCCAGAATCTACAAAGG + Intergenic
1159697953 18:71585084-71585106 CTATTATAGCCAATTTACATTGG + Intergenic
1160640411 19:127395-127417 ATTATATACAAAATCTAGATTGG + Intergenic
1164403481 19:27920277-27920299 TTAATATCCCTAATCTATATAGG + Intergenic
1164597108 19:29537557-29537579 CTAAAATATCAAAGCTACTTTGG + Intronic
1168502108 19:56901558-56901580 CTAATATCCAGAATCTACAATGG - Intergenic
1168675392 19:58274120-58274142 CTAATACACCAAATATTGATAGG - Intronic
925570611 2:5308496-5308518 CTATTATATCAAATCTTAATGGG + Intergenic
925835980 2:7947463-7947485 CAAATGTACAAACTCTACATTGG - Intergenic
925937726 2:8782603-8782625 AAATTATACCAACTCTACATAGG + Intronic
926477647 2:13347027-13347049 CTAAAATTTCAAATATACATAGG - Intergenic
927527775 2:23763152-23763174 CTAATACTCCCAATCTAGATAGG - Intronic
928472858 2:31591199-31591221 CTAATATCCAGAATCTACAATGG + Intergenic
932874499 2:75436253-75436275 CTAATATCCAGAATCTACAAGGG + Intergenic
932935955 2:76101410-76101432 CTAATATACAGAATCTATAAGGG + Intergenic
933474738 2:82775751-82775773 CTAATATCCAGAATCTACAAGGG + Intergenic
940134342 2:150419208-150419230 CTGGTATACCAACTCTACATGGG + Intergenic
940401406 2:153252349-153252371 CTAATATCCAGAATCTACAATGG - Intergenic
942475014 2:176310538-176310560 TGAAAAGACCAAATCTACATTGG - Intronic
942814834 2:180040533-180040555 CTTGTATACCAAATATACAATGG - Intergenic
943679266 2:190750872-190750894 CTAATATCCAGAATCTACAAGGG + Intergenic
944002043 2:194851439-194851461 CTAATATTCAGAATCTACAAAGG - Intergenic
1170108035 20:12773224-12773246 CTAATATCCAGAATCTACAAAGG - Intergenic
1170126886 20:12973514-12973536 CTAATATCCAGAATCTACAAGGG - Intergenic
1171151600 20:22831497-22831519 CTAATATCCAGAATCTACATAGG - Intergenic
1171357185 20:24556947-24556969 TGAAAAGACCAAATCTACATCGG - Intronic
1172430157 20:34883833-34883855 CTACTATACCGAATCCAAATAGG + Intronic
1173568807 20:44063248-44063270 CTAATATCCAGAATCTACAAAGG + Intronic
1175016382 20:55795848-55795870 CTTAATTCCCAAATCTACATAGG + Intergenic
1176698188 21:10006720-10006742 CTAATATCCAGAATCTACAAAGG - Intergenic
1178231855 21:30794934-30794956 CTAATATACAGATTCTACAAGGG + Intergenic
1180435926 22:15304092-15304114 CTAATATCCAGAATCTACAAAGG + Intergenic
1184699401 22:46160273-46160295 CCAATATAAGAAATCTATATTGG + Intronic
949335718 3:2972974-2972996 TTAATAGCCCAAATCTACAAGGG - Intronic
950619196 3:14189677-14189699 CTAATATCCAGAATCTACAAAGG - Intronic
950792190 3:15481081-15481103 CTAATATCCAAAATCTACAAAGG - Intronic
951608133 3:24459832-24459854 CTAATATCCAGAATCTACAAAGG + Intronic
951631668 3:24728409-24728431 CTAAAATACCACATGAACATTGG - Intergenic
953756520 3:45651211-45651233 CTAATATCCAGAATCTACAAAGG - Intronic
954875108 3:53797879-53797901 TTAATGTACCAAATTTACTTGGG + Intronic
956261554 3:67348964-67348986 TTAATATACCAAAGCTGAATGGG + Intergenic
957645991 3:82927827-82927849 CATATATACAAAATCTACACAGG + Intergenic
957668574 3:83269655-83269677 CTAATATCCAGAATCTACAAGGG - Intergenic
957756366 3:84493465-84493487 CTAATATCCATAATCTACAAGGG + Intergenic
959713264 3:109405846-109405868 CTAATATCCAGAATCTACAAGGG - Intergenic
959854418 3:111132406-111132428 GAAAAATACTAAATCTACATGGG - Intronic
961093362 3:124134638-124134660 CTAATATCCAGAATCTACAACGG + Intronic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
962211416 3:133482120-133482142 CTAATATCCAGAATCTACAAAGG + Intergenic
962556784 3:136561064-136561086 TTAATATCCAAAATCTAGATTGG - Intronic
964845874 3:161043625-161043647 CTAAGAAACCAATTCAACATTGG - Intronic
965097573 3:164253248-164253270 GTAATATTCACAATCTACATAGG + Intergenic
965767909 3:172150923-172150945 AAAAAATAACAAATCTACATAGG + Intronic
965830349 3:172779486-172779508 CCAATATATAAAATCCACATAGG - Intronic
966342193 3:178937740-178937762 CTAATATCCAGAATCTACAATGG - Intergenic
969165851 4:5311126-5311148 TTTCTATACCACATCTACATAGG - Intronic
971022448 4:22550844-22550866 CTAATATACCAAACCAAGAAAGG - Intergenic
972146498 4:36033525-36033547 CTAATATACAGAATCTATAAGGG - Intronic
972887780 4:43513585-43513607 CTAATATCCAGAATCTACAAGGG - Intergenic
972980063 4:44687057-44687079 CTATTATACCACCTTTACATTGG - Intronic
973006618 4:45015535-45015557 CTAATATCCAGAATCTATATGGG - Intergenic
973836248 4:54812329-54812351 CTAATATACAGAATCAACAAAGG + Intergenic
974162225 4:58154780-58154802 CTAATATCCAGAATCTACAAAGG + Intergenic
974715582 4:65666679-65666701 CTAATATACTAAAACTACTAAGG + Intronic
974990086 4:69076661-69076683 CTAATATCCAGAATCTACAAAGG - Intronic
976998824 4:91469099-91469121 CTAATATACCAAATCTACATTGG + Intronic
977829135 4:101569724-101569746 CTAATATCCAGAATCTACAAGGG + Intronic
977858491 4:101926120-101926142 AGTATATACCCAATCTACATTGG - Intronic
977910323 4:102526857-102526879 ATAATCTAACAAATCTACATTGG + Intronic
978359889 4:107919709-107919731 CTAATATACCTTATAAACATTGG + Intergenic
979026664 4:115586196-115586218 CTAATATCCAGAATCTACAAAGG - Intergenic
980604751 4:135075521-135075543 CTAATATCCAGAATCTACAAAGG - Intergenic
981161533 4:141504765-141504787 CTAATATCCAGAATCTACAAGGG - Intergenic
982311871 4:153994627-153994649 CTAATATCCAGAATCTACAACGG - Intergenic
982896661 4:160938199-160938221 CTAATATCCAGAATCTACAAGGG + Intergenic
982944089 4:161596908-161596930 CTAATATCCAGAATCTACAAAGG - Intronic
983031385 4:162806392-162806414 TTAATATCTAAAATCTACATGGG - Intergenic
983429535 4:167631057-167631079 CTAATATCCAGAATCTACAAAGG + Intergenic
984228256 4:177062477-177062499 CAAATATCCAAAATCTACAATGG + Intergenic
985745810 5:1646692-1646714 CTAATATCCAGAATCTACAAAGG + Intergenic
986523631 5:8649047-8649069 CAAATATACCACATCTAAAGTGG - Intergenic
987893650 5:23916819-23916841 CTAATATCCAGAATCTACAATGG - Intergenic
991146151 5:63307250-63307272 CTAATATCCCAATTCCACAAGGG - Intergenic
991161863 5:63512545-63512567 CTAATATCCAGAATCTACAAAGG + Intergenic
991233742 5:64368573-64368595 CTAATATCCAGAATCTACAATGG + Intronic
992319765 5:75601987-75602009 CTAATATAACAAATTGACTTAGG - Intergenic
992970206 5:82048661-82048683 CTAATATCCAGAATCTACAATGG + Intronic
994310236 5:98260596-98260618 ATAATATTACAAATATACATTGG - Intergenic
997219804 5:132151972-132151994 CTAATATCCAGAATCTACAAGGG - Intergenic
997750990 5:136345577-136345599 CTAATATCCAGAATCTACAAAGG - Intronic
998691097 5:144589316-144589338 CTAATATTCAGAATCTACAAGGG - Intergenic
998710912 5:144824218-144824240 CTAATATCCAGAATCTACAAAGG - Intergenic
999963955 5:156788060-156788082 CTAATATCCAGAATCTACAAAGG + Intergenic
999981011 5:156957866-156957888 TTAATTTACCAAATATTCATAGG - Intronic
1001806029 5:174587266-174587288 CAAAAATACCTAATTTACATAGG - Intergenic
1002736939 5:181399020-181399042 ATTATATACAAAATCTAGATTGG - Intergenic
1002747760 6:75798-75820 ATTATATACAAAATCTAGATTGG + Intergenic
1003134653 6:3425125-3425147 TTATTATACCAAATTTATATAGG + Intronic
1003738355 6:8904758-8904780 CTCATTTACTCAATCTACATGGG - Intergenic
1007844974 6:44746495-44746517 CTAATATCCAGAATCTACAAAGG - Intergenic
1008262348 6:49382138-49382160 CTAATATTCAGAATCTACAAGGG - Intergenic
1009244763 6:61222980-61223002 CTAATATCCAGAATCTACATGGG + Intergenic
1009377006 6:62985085-62985107 CTAATATCCAGAATCTACAAAGG - Intergenic
1009556837 6:65181320-65181342 CTAATATCCAGAATCTACAATGG + Intronic
1009592602 6:65691460-65691482 CTAATATCCAGAATCTACAAAGG - Intronic
1010553982 6:77256768-77256790 CTAATATCCAGAATCTACAAAGG + Intergenic
1010661140 6:78571891-78571913 CTAATATCCAGAATCTACAAAGG + Intergenic
1010860672 6:80906471-80906493 CTAATATCCAAAATCTTCAAAGG + Intergenic
1011303746 6:85903908-85903930 CTAATATCCAGAATCTACAAGGG - Intergenic
1011305828 6:85925388-85925410 CTAATATCCGGAATCTACAAGGG - Intergenic
1014654847 6:124089065-124089087 CTAATATATAAAATTTTCATTGG + Intronic
1014702482 6:124707719-124707741 CTAATATCCAGAATCTACAATGG - Intronic
1014704657 6:124730823-124730845 CTAATATCCAGAATCTACAATGG + Intronic
1016730827 6:147425812-147425834 CTAATATCCAGAATCTACAAGGG - Intergenic
1017078557 6:150643534-150643556 CTGATATACAATATCTAGATTGG + Intronic
1018249778 6:161857544-161857566 TCAATCTAGCAAATCTACATTGG + Intronic
1019242036 6:170674554-170674576 ATTATATACAAAATCTAGATTGG - Intergenic
1024456110 7:49609094-49609116 CTAATATACAGCATCTACAGGGG - Intergenic
1025033746 7:55578060-55578082 CTAATATCCAGAATCTACAAAGG - Intergenic
1027360406 7:77402628-77402650 TTTGTATACCAAATCTAGATGGG - Intronic
1027691182 7:81346714-81346736 TTAATATAGCAAATCTAAAATGG + Intergenic
1028882089 7:95891665-95891687 ATAGTATACCAAATATACAGGGG + Intronic
1029849735 7:103449238-103449260 CTAATATCCACAATCTACAAAGG - Intergenic
1030519101 7:110575304-110575326 CTGATAAAAAAAATCTACATGGG - Intergenic
1030633125 7:111917320-111917342 CTAATATAGTAAATATAGATGGG - Intronic
1030661705 7:112225798-112225820 ATAGTATACTAAATTTACATTGG - Intronic
1030984340 7:116223485-116223507 TTAAAATACCAAATATACTTGGG - Intronic
1032376282 7:131421857-131421879 CAAATATACCAAAATAACATTGG - Intronic
1035506081 8:133547-133569 ATTATATACAAAATCTAGATTGG + Intergenic
1037073866 8:14688072-14688094 CTAATATCCAAAATCTACAATGG - Intronic
1037125657 8:15345625-15345647 CTAATATCCAGAATCTACAAAGG - Intergenic
1039789295 8:40861682-40861704 CTAATATCCAGAATCTACAAAGG + Intronic
1040540802 8:48353201-48353223 TGAAAAGACCAAATCTACATTGG + Intergenic
1042418548 8:68557215-68557237 CTAAAATGCCAAATATAAATAGG - Intronic
1042511154 8:69612731-69612753 CTAATATCCAGAATCTACAAAGG - Intronic
1043192323 8:77241350-77241372 CTAATTTACCATATCAACATGGG - Intergenic
1043679298 8:83001875-83001897 CTAATATCCAGAATCTACAAAGG + Intergenic
1044074833 8:87807585-87807607 CTAATATCCAGAATCTACAAGGG + Intergenic
1048526043 8:135203764-135203786 CTAATATTCCGAATCTATAAGGG + Intergenic
1048756078 8:137739604-137739626 CTAATATCCAGAATCTACAAGGG - Intergenic
1050748325 9:8904769-8904791 CTAAAATAACAAATGTACTTGGG + Intronic
1051285837 9:15494739-15494761 ATAATTTACCAAATTTACTTTGG + Intronic
1051321606 9:15911424-15911446 CTAATATCCAGAATCTACAAGGG - Intronic
1051413718 9:16817077-16817099 CTAAAATATCAAAATTACATAGG + Intronic
1051758226 9:20429569-20429591 CTAATAGACCAAAACCACATTGG + Intronic
1052440882 9:28495095-28495117 CTAATATCCAGAATCTACAAAGG - Intronic
1052592709 9:30519418-30519440 CTAAAATACCATATTTAAATTGG - Intergenic
1052635682 9:31101388-31101410 CTAACATCCAAAATCTACAAGGG - Intergenic
1057324576 9:94049855-94049877 TGAAAAGACCAAATCTACATCGG - Intronic
1203602227 Un_KI270748v1:23788-23810 ATTATATACAAAATCTAGATTGG - Intergenic
1187021085 X:15382718-15382740 CTCAAATTCCAAATTTACATGGG - Intronic
1187235848 X:17466384-17466406 GTTATATACCAATTCTACCTGGG - Intronic
1187730053 X:22243545-22243567 CTAATATCCAGAATCTACAAAGG + Intronic
1188476081 X:30593710-30593732 CTAATGAACCAAATCTCCAGGGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1191045724 X:56134764-56134786 CTAATATCCAGAATCTACAAGGG + Intergenic
1191087238 X:56582401-56582423 CTAATATCCAGAATCTACAATGG - Intergenic
1191113794 X:56831238-56831260 TGAAAAGACCAAATCTACATTGG - Intergenic
1191134638 X:57050403-57050425 TGAAAAGACCAAATCTACATCGG + Intergenic
1191170265 X:57439480-57439502 CTAATATCCAGAATCTACAATGG - Intronic
1191681050 X:63840130-63840152 GTGAAAGACCAAATCTACATCGG + Intergenic
1191763501 X:64669476-64669498 CTAATATCCAGAATCTACAATGG + Intergenic
1191824638 X:65351580-65351602 CTAATATCCAGAATCTACAAAGG + Intergenic
1192253539 X:69434600-69434622 CTAATATCCAGAATCTACAAAGG - Intergenic
1193550784 X:82890335-82890357 CTAATATCCCGAATCTACAAAGG + Intergenic
1193590367 X:83382222-83382244 CTAATATCCAGAATCTACAAAGG + Intergenic
1195456978 X:105080097-105080119 CTAATATCCGGAATCTACAAAGG - Intronic
1196139469 X:112245336-112245358 TGAAAAGACCAAATCTACATTGG - Intergenic
1196149118 X:112352944-112352966 CTAATATCCAGAATCTACAATGG + Intergenic
1196159488 X:112467079-112467101 CTAATATCCAGAATCTACAAAGG + Intergenic
1196674135 X:118401548-118401570 CTAATATCCAGAATCTACAATGG - Intronic
1197087119 X:122491834-122491856 CTAATATCCAGAATCTACAAGGG - Intergenic
1197331301 X:125156289-125156311 CTCATATAACAAACCTACACAGG - Intergenic
1198309285 X:135414239-135414261 CTAATATCCAGAATCTACAAGGG + Intergenic
1199268608 X:145856739-145856761 CTAATAAAACAAACCTCCATTGG + Intergenic