ID: 977000460

View in Genome Browser
Species Human (GRCh38)
Location 4:91492380-91492402
Sequence TTATACAATTGTAGTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 579}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977000460_977000462 -4 Left 977000460 4:91492380-91492402 CCAAAAAAACTACAATTGTATAA 0: 1
1: 1
2: 3
3: 33
4: 579
Right 977000462 4:91492399-91492421 ATAAAGTGCTCTCGGAGATCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
977000460_977000465 26 Left 977000460 4:91492380-91492402 CCAAAAAAACTACAATTGTATAA 0: 1
1: 1
2: 3
3: 33
4: 579
Right 977000465 4:91492429-91492451 AGCACTGCTGTCTCTTCCCAGGG No data
977000460_977000463 -3 Left 977000460 4:91492380-91492402 CCAAAAAAACTACAATTGTATAA 0: 1
1: 1
2: 3
3: 33
4: 579
Right 977000463 4:91492400-91492422 TAAAGTGCTCTCGGAGATCTGGG 0: 1
1: 0
2: 0
3: 6
4: 66
977000460_977000464 25 Left 977000460 4:91492380-91492402 CCAAAAAAACTACAATTGTATAA 0: 1
1: 1
2: 3
3: 33
4: 579
Right 977000464 4:91492428-91492450 AAGCACTGCTGTCTCTTCCCAGG 0: 1
1: 0
2: 0
3: 35
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977000460 Original CRISPR TTATACAATTGTAGTTTTTT TGG (reversed) Intronic
900843170 1:5072826-5072848 TTAAACAATTGAATTTATTTTGG - Intergenic
901552431 1:10005531-10005553 TTATACTATTGTTTTATTTTTGG + Intronic
902132674 1:14276985-14277007 TTATACAATTGTCCTTTGTCTGG + Intergenic
902358590 1:15927579-15927601 TTATAGAATAGTAATTTTGTGGG + Intronic
903303664 1:22397044-22397066 TTGAACAATTGCAGTTTTCTTGG + Intergenic
903377911 1:22878013-22878035 TTCTACAATTGTCCTTTGTTGGG + Intronic
904098916 1:28005741-28005763 TTATAGATGTGTGGTTTTTTGGG - Intronic
905968397 1:42118846-42118868 TTAAACAATTGTGATATTTTGGG - Intergenic
906831151 1:49033229-49033251 TTAAACAAGTGTAGTGGTTTTGG - Intronic
907081796 1:51630211-51630233 GAAGACAATTGTGGTTTTTTTGG + Intronic
907645664 1:56240644-56240666 TTATACAATTTTAGCTGCTTTGG + Intergenic
908015745 1:59833391-59833413 TTTTAATATTGTAGTTTTTGGGG + Exonic
908264743 1:62367228-62367250 GTAAACAATTGAAGTTTATTTGG - Intergenic
908524196 1:64971904-64971926 TTCTTCAAGTGTAGTTTTTTAGG - Intergenic
908869751 1:68595688-68595710 TTATACATTTGTTTTTTATTAGG - Intergenic
909169682 1:72280293-72280315 TTATTAAATTGTTGTTTGTTTGG + Intronic
909237240 1:73168746-73168768 TAATAAAAATGTAGTTATTTTGG + Intergenic
909424867 1:75511480-75511502 TTCTGCATTTGTAGTTTTTTTGG - Intronic
909897795 1:81095137-81095159 TAATATAATTATTGTTTTTTGGG - Intergenic
909941494 1:81616624-81616646 GTATCCACTTCTAGTTTTTTGGG + Intronic
910294418 1:85629840-85629862 TTATGCACTTGGAGGTTTTTAGG - Intergenic
910817622 1:91308958-91308980 TTATAAAATTATAATTTTTAGGG - Intronic
910835497 1:91504863-91504885 TTATATACATGTACTTTTTTAGG + Intronic
910933174 1:92462808-92462830 TCATACAATTGTACTTATTCAGG + Intergenic
911210818 1:95136544-95136566 TTATACAATTTTCTCTTTTTTGG - Intronic
911453709 1:98096949-98096971 TAATACAATTGTATTATATTTGG + Intergenic
911606432 1:99910690-99910712 TTATACACATTTTGTTTTTTAGG + Exonic
912986692 1:114440348-114440370 TTATGCAATTTTTTTTTTTTTGG - Intronic
915077611 1:153322548-153322570 TTAAAAAATTTTAGTTTCTTTGG - Intergenic
916513243 1:165492079-165492101 TTAAACAATTTTTCTTTTTTTGG + Intergenic
916986911 1:170201576-170201598 ATAAACAATAGTAGTTTGTTTGG + Intergenic
917400596 1:174645012-174645034 TAATAAAATTGTATTGTTTTAGG + Intronic
917761301 1:178161597-178161619 TGACACATTTTTAGTTTTTTGGG + Intronic
917818103 1:178731250-178731272 TTATACTTTTCTAGTTGTTTTGG + Intronic
917823097 1:178786740-178786762 AGATACAATTTTAGTTCTTTCGG + Intronic
917982763 1:180282073-180282095 TTATTCAATTTTTGTGTTTTTGG - Intronic
917983943 1:180295698-180295720 TGTTACTATTGTAATTTTTTGGG + Intronic
917988120 1:180342407-180342429 TAATCCAATTGTAGTGTTTAGGG + Intronic
919072221 1:192770444-192770466 TTTTACAGTTGTAGATTTTTGGG - Intergenic
919075166 1:192804543-192804565 ATATACATTAGTATTTTTTTAGG + Intergenic
919946170 1:202320382-202320404 TTAGGAAATTGTAGTTTTCTGGG + Intergenic
920729725 1:208472064-208472086 TTTTCCAACTGTAATTTTTTGGG - Intergenic
921061264 1:211586674-211586696 TTATTCATTTTTAGTCTTTTAGG - Intergenic
921111385 1:212041298-212041320 GTAAAAAATTGTAGGTTTTTTGG + Intronic
921761548 1:218921061-218921083 TATTACTATTGTAGTTGTTTGGG - Intergenic
923878956 1:238082890-238082912 ATATACCATTGTATGTTTTTTGG + Intergenic
924006749 1:239620093-239620115 TTTTAAAATTATAGTTTTGTGGG + Intronic
924161109 1:241232944-241232966 TTAAATTATTGTAGTTTTGTAGG + Intronic
924414178 1:243841437-243841459 TTATATTATTCTACTTTTTTTGG - Intronic
1063422772 10:5926726-5926748 GTTTACAAATGTAATTTTTTTGG + Intronic
1063515570 10:6691501-6691523 GTATACTATAGTAGTTATTTTGG + Intergenic
1063552432 10:7045672-7045694 TTATAGAATTGTTTTTTTGTTGG - Intergenic
1063804037 10:9616861-9616883 TATTACTATTGTAGTTGTTTTGG - Intergenic
1063990860 10:11561184-11561206 TTCTACAATGTTATTTTTTTTGG - Intronic
1064995174 10:21290478-21290500 TAAGACAATTGTATTTTTTTTGG - Intergenic
1065336955 10:24662600-24662622 TAATACAATTGTAATATATTTGG - Intronic
1065632685 10:27697004-27697026 TGATACAATTTAAGTCTTTTAGG - Intronic
1065666657 10:28070460-28070482 TTATGCAATTGAATTTTCTTAGG - Intronic
1066977893 10:42386222-42386244 TTATATAATGGGAGTTTTGTAGG + Intergenic
1067306706 10:45071301-45071323 TTATACACTTGCAGTTATTGAGG - Intergenic
1068138211 10:52972146-52972168 TTTTTCAATTATAGTTGTTTTGG - Intergenic
1068465403 10:57383472-57383494 TTATACATTTGTTGTTTGCTTGG - Intergenic
1068468203 10:57423968-57423990 TTATAAAATTGGGGATTTTTTGG - Intergenic
1068644579 10:59451388-59451410 TTATGTAAATGTAGTTATTTGGG - Intergenic
1068733114 10:60382040-60382062 TTACAAAATTGTACTTTATTAGG + Intronic
1069910531 10:71756152-71756174 TTTTAAACTTGTACTTTTTTTGG - Intronic
1070092773 10:73304638-73304660 TTATAGAACTGTAAATTTTTTGG + Intronic
1070183972 10:74042097-74042119 TTATACATGTGGATTTTTTTTGG + Intronic
1070910644 10:80115074-80115096 TTTTACACTTGTGGGTTTTTCGG + Intergenic
1071367287 10:84912084-84912106 TTGTACAATAGTTGTTTTGTGGG - Intergenic
1071952939 10:90725673-90725695 TTATAAAATTGAAGTTTTAAGGG + Intergenic
1072912696 10:99518093-99518115 TAATACTATTGTAATTATTTTGG - Intergenic
1073088492 10:100912360-100912382 TTATTCCAATGGAGTTTTTTGGG + Intergenic
1073812548 10:107165884-107165906 TCATACAATTATAGAATTTTAGG - Intergenic
1074084681 10:110200186-110200208 TTTTACTATTGTAATTTTTGGGG - Intergenic
1075136008 10:119786958-119786980 TTTTAGAATTCAAGTTTTTTGGG + Intronic
1077748188 11:4932671-4932693 ATATATAATTGTTGTTGTTTTGG + Intronic
1077750459 11:4962358-4962380 TTATGAAATTATAGATTTTTAGG + Intronic
1078675168 11:13405132-13405154 TTGTAGAATTATAGTTCTTTTGG - Intronic
1078847917 11:15138179-15138201 TATTACTATTGTAGTTGTTTTGG - Intronic
1078951039 11:16134669-16134691 TGTTACTATTGTAGTTGTTTTGG + Intronic
1080256915 11:30300542-30300564 TTTTAAAATAGTATTTTTTTTGG - Intergenic
1080257559 11:30307973-30307995 TTATACAATATCTGTTTTTTTGG - Intergenic
1080840204 11:35976964-35976986 ATTTACAAATGTGGTTTTTTGGG + Intronic
1081248658 11:40801707-40801729 CTATGCAATTGTCATTTTTTAGG + Intronic
1081310301 11:41562344-41562366 TAATACATTTTTAGTCTTTTAGG + Intergenic
1081554649 11:44147252-44147274 TTATAGAATTGTAGTCTCCTTGG + Intronic
1082280212 11:50263531-50263553 TTATACATATGTAATTTTATAGG + Intergenic
1082615223 11:55350992-55351014 CTATACATTTGTAGTATATTTGG + Intergenic
1082654482 11:55836678-55836700 TTAAACAATTGTATTATCTTTGG - Intergenic
1082945654 11:58756055-58756077 TTATAAAATTTTAATTTTTATGG - Intergenic
1083071455 11:59987623-59987645 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1083913140 11:65721513-65721535 TTATTCATTTTTAGTTTATTAGG + Intergenic
1084360499 11:68665917-68665939 TTATACATTTCTCTTTTTTTTGG + Intergenic
1086007896 11:82061792-82061814 TTTTACATTTATAATTTTTTTGG - Intergenic
1086099813 11:83087334-83087356 TTATTCTACTGTAGCTTTTTTGG - Intergenic
1086544934 11:87956964-87956986 GTATAAAAATGCAGTTTTTTGGG + Intergenic
1087298359 11:96403785-96403807 TTATACAATGGAATGTTTTTTGG + Intronic
1087812168 11:102620504-102620526 TGTTAAAATTGTAGATTTTTGGG + Intronic
1088111040 11:106261734-106261756 TTATACAACTAGAGTTTTATGGG + Intergenic
1088164034 11:106910306-106910328 TTATAATATTGTTGTATTTTTGG - Intronic
1088189698 11:107214879-107214901 TTATGGAATTGTAGGATTTTAGG - Intergenic
1088272385 11:108047644-108047666 TTTTTAAATTGTAGTTTTATAGG + Intronic
1089651662 11:119918357-119918379 TCATAGAATTATAGTTTTTAGGG - Intergenic
1090289087 11:125526198-125526220 TAAGACAATTGCAGTTCTTTTGG - Intergenic
1090509722 11:127362385-127362407 TTATAGAAATCTAGTATTTTGGG - Intergenic
1090771420 11:129922990-129923012 TTATACATTTGGATTCTTTTAGG + Intronic
1093002209 12:14009896-14009918 TTATACAATTCTATGGTTTTTGG - Intergenic
1093483594 12:19629288-19629310 TTTTACAATTGTTATTTCTTGGG + Intronic
1093740907 12:22687035-22687057 TCACACTATTGTAGGTTTTTTGG + Exonic
1094059249 12:26295994-26296016 TTTTACTATTGCAGTTGTTTTGG - Intronic
1094685271 12:32706467-32706489 TTAAACAGTTCTAGTTTTTCTGG + Intronic
1095312033 12:40710363-40710385 TTTTACTATTGTAATTGTTTTGG - Intronic
1096324270 12:50645110-50645132 TTATACAATTGTAGTGTCCTTGG - Intronic
1097092621 12:56519324-56519346 TTATAAAAATTTAGATTTTTCGG + Intergenic
1097462536 12:59879844-59879866 TTTTAAAATTGTAGTTTTGGAGG - Intergenic
1097474050 12:60032287-60032309 TACTATAATTGTATTTTTTTAGG + Intergenic
1097490446 12:60262484-60262506 GTATACAATTGTAGACCTTTAGG + Intergenic
1097534581 12:60850773-60850795 TTATATAATTGTATAATTTTAGG + Intergenic
1098367908 12:69724713-69724735 TTTTATAATTGTATTTTTATTGG + Intergenic
1098412396 12:70200663-70200685 TTTTATAATTATAGTTTTTAGGG - Intergenic
1098894821 12:76046285-76046307 TTATAAAATTGAAGTTTTAAGGG - Exonic
1100102792 12:91129867-91129889 TACCACAACTGTAGTTTTTTGGG + Intergenic
1100468263 12:94868018-94868040 TGATACTATTGTAATTGTTTCGG + Intergenic
1101497744 12:105271733-105271755 ATACAAAATTGTAGTTTTTCAGG - Intronic
1101684324 12:107002565-107002587 TAATAAAATTGTATTTTATTTGG - Intronic
1102185766 12:110947382-110947404 CTATACAAGGGAAGTTTTTTGGG - Intergenic
1104592604 12:130096750-130096772 TTATATATTTGTCTTTTTTTAGG + Intergenic
1105675642 13:22669003-22669025 TTATACCATGTTACTTTTTTTGG - Intergenic
1105924240 13:24992575-24992597 TTATCTTATTGTTGTTTTTTTGG + Intergenic
1106147922 13:27067882-27067904 GTAAACGATTGCAGTTTTTTTGG - Exonic
1106153277 13:27126711-27126733 TTTTAGAATTGTAGCATTTTGGG - Intronic
1107762991 13:43701783-43701805 TCATACTATTGTAGTTTCTTGGG - Intronic
1108009968 13:45996124-45996146 TAATACATTAGTAGTATTTTAGG - Intronic
1108147434 13:47493656-47493678 TTTTTAAATTATAGTTTTTTTGG - Intergenic
1108218628 13:48210680-48210702 TTGCACAATTGTATGTTTTTTGG - Intergenic
1108615775 13:52130306-52130328 TCATAGAATTTTAGTTTTTCTGG + Intergenic
1109003898 13:56844523-56844545 TAATATAATTTAAGTTTTTTAGG - Intergenic
1109375937 13:61493198-61493220 TTATACATATATACTTTTTTGGG + Intergenic
1109459261 13:62633436-62633458 TGATATTATTGTAGTTGTTTTGG - Intergenic
1109681878 13:65762578-65762600 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1110524483 13:76520139-76520161 GTATACAATTGTAAATTGTTTGG - Intergenic
1110876841 13:80520521-80520543 TTCTAAAATTCTCGTTTTTTTGG - Intergenic
1110964733 13:81678697-81678719 TTATGCAATTGAAATTATTTTGG - Intergenic
1111071628 13:83175619-83175641 TTCTACAATTTTTGTTATTTTGG - Intergenic
1111293413 13:86198014-86198036 TTATGAAATTATAGTTTTATGGG + Intergenic
1111548242 13:89773048-89773070 GTATACAAGTGTAGGCTTTTGGG - Intergenic
1111562905 13:89975993-89976015 TTTTAATATTGTATTTTTTTAGG + Intergenic
1111818737 13:93187942-93187964 TGCTGCAATTTTAGTTTTTTGGG - Intergenic
1111977806 13:94985940-94985962 TTATACAATTATATTGTGTTAGG + Intergenic
1112849545 13:103688123-103688145 GTATACAATTGTAGTTAGATAGG - Intergenic
1112868383 13:103937425-103937447 TTACAAAATAGCAGTTTTTTTGG - Intergenic
1112950561 13:104990704-104990726 TGATACAATTATAGTTGCTTTGG + Intergenic
1114844447 14:26304163-26304185 TACTACAAGTGTATTTTTTTTGG - Intergenic
1114937487 14:27559938-27559960 TTCAACAATTGTAATTTTTATGG + Intergenic
1114993831 14:28321384-28321406 TAATACAATTGTATTATATTAGG + Intergenic
1115514076 14:34167916-34167938 TTACACAATTGTCATTTTCTGGG + Intronic
1115740786 14:36385686-36385708 TGTTACTATTGTAGTTGTTTTGG + Intergenic
1116258459 14:42588682-42588704 TTATTTTATTGTACTTTTTTAGG + Intergenic
1116527472 14:45924106-45924128 TTGTACAATTTTAGTGTTGTTGG + Intergenic
1116721868 14:48507341-48507363 CTATACAGTTCTAGATTTTTAGG - Intergenic
1116892409 14:50281638-50281660 TTATAAAATTCTGGTTTTATAGG + Intronic
1118424530 14:65645243-65645265 TTATACAATTGTAACTTGTTAGG - Intronic
1118670963 14:68126692-68126714 TTCTGCAATTGTACCTTTTTTGG + Intronic
1118863160 14:69681361-69681383 TTATAAAGTTTTATTTTTTTAGG - Intronic
1120385753 14:83843615-83843637 TTATACTAATGTACTTTCTTTGG - Intergenic
1120698256 14:87668552-87668574 TAATACATTTGTTGTTTTTGTGG - Intergenic
1121056941 14:90863613-90863635 TTATAGAAATATAGTTTTTTTGG - Exonic
1122569658 14:102687431-102687453 TAATACTATACTAGTTTTTTTGG + Intronic
1122678125 14:103434213-103434235 CTATACAATTTTAGTTGATTTGG - Intronic
1122764017 14:104052719-104052741 TTGTACAATTTCAGATTTTTTGG - Intergenic
1123424728 15:20160954-20160976 TTGAACAATTGTATATTTTTGGG + Intergenic
1123485895 15:20738216-20738238 TTATTAAATTGGAGGTTTTTGGG - Intergenic
1123533952 15:21167485-21167507 TTGAACAATTGTATATTTTTGGG + Intergenic
1124042077 15:26114903-26114925 ATATAATACTGTAGTTTTTTAGG + Intergenic
1125278083 15:38014661-38014683 TTAAACAATTTTAGTCTTGTGGG - Intergenic
1125296435 15:38208368-38208390 TTACACACTTCTAGGTTTTTAGG - Intergenic
1125299593 15:38240560-38240582 TTATACAGTTCTAAGTTTTTAGG + Intergenic
1125319583 15:38470084-38470106 TTCTACAACTGTTGTTCTTTGGG + Intronic
1126719698 15:51565226-51565248 TGATAAAATGGTAGTGTTTTGGG - Intronic
1127249506 15:57216790-57216812 TCAAACAGTTTTAGTTTTTTGGG + Intronic
1128483079 15:68055704-68055726 ATATACAATTGTAAATCTTTGGG + Intronic
1129813962 15:78535657-78535679 TTTTAGAATTGTAGAATTTTAGG + Exonic
1130042485 15:80416758-80416780 TTCTAAAATTTTAATTTTTTTGG + Intronic
1202950701 15_KI270727v1_random:34401-34423 TTATTAAATTGGAGGTTTTTGGG - Intergenic
1132975425 16:2708932-2708954 TTATACTTTTATACTTTTTTAGG + Exonic
1134518279 16:14904569-14904591 TAATCCAATAGTACTTTTTTGGG - Intronic
1134705950 16:16303227-16303249 TAATCCAATAGTACTTTTTTGGG - Intergenic
1134961590 16:18408883-18408905 TAATCCAATAGTACTTTTTTGGG + Intergenic
1134965890 16:18491486-18491508 TAATCCAATAGTACTTTTTTGGG + Intronic
1135222961 16:20629330-20629352 TTATACAATTGAAGTTAAGTAGG + Intronic
1137266844 16:46875846-46875868 TTTTTGAATTCTAGTTTTTTTGG - Intergenic
1139018444 16:62718588-62718610 TTAAAAGATTGTATTTTTTTTGG + Intergenic
1139232573 16:65298545-65298567 GTACCCAAGTGTAGTTTTTTTGG - Intergenic
1140493168 16:75358088-75358110 TGATACTATTGTAATTGTTTTGG - Intronic
1140657761 16:77157855-77157877 ATATACAATTATAGTTTATCTGG - Intergenic
1140777832 16:78266175-78266197 TTTTACATTTGTAATTGTTTGGG + Intronic
1140910805 16:79450238-79450260 TTATAAAATTGTGATTGTTTAGG + Intergenic
1142793158 17:2284802-2284824 TTATATAATTTTAATCTTTTTGG - Intronic
1144136169 17:12297155-12297177 TTCTACAATCCTAGATTTTTTGG - Intergenic
1144248293 17:13390054-13390076 TCATACAATTGGAGTTTTTTTGG - Intergenic
1144544646 17:16181552-16181574 TAATACAATTGTATTATATTAGG + Intronic
1144545089 17:16187318-16187340 TTATATACTTGTAATTCTTTGGG - Intronic
1145371435 17:22309778-22309800 TTATATTATTGTTATTTTTTTGG - Intergenic
1145407048 17:22609924-22609946 ATATATAATTTTAGTTTTCTTGG + Intergenic
1146493036 17:33295848-33295870 TTATACACTATTTGTTTTTTAGG + Intronic
1146537416 17:33664956-33664978 TTTAACAATTGCAGCTTTTTGGG - Intronic
1146538732 17:33676089-33676111 TGTTACTATTGTAGTTGTTTTGG + Intronic
1148286383 17:46396588-46396610 TATTACCATTGTAGTTTTTTAGG + Intergenic
1148308549 17:46614180-46614202 TATTACCATTGTAGTTTTTTAGG + Intronic
1148370294 17:47094646-47094668 TTATACACCTATTGTTTTTTAGG - Intergenic
1149082187 17:52671650-52671672 TTATGCTATTATAGTTATTTGGG - Intergenic
1149413615 17:56434989-56435011 AAATACACTTTTAGTTTTTTTGG + Intronic
1149729017 17:58925899-58925921 TTATATATATGTATTTTTTTAGG - Intronic
1150598047 17:66624365-66624387 TTCTACTATTGTAGTACTTTGGG + Intronic
1151869955 17:76829763-76829785 TTGTATTATTGTAGTTTTTTTGG - Intergenic
1152193072 17:78900243-78900265 TATTAAAATTGTGGTTTTTTTGG + Intronic
1152846479 17:82602888-82602910 TTATTTAAATGTAGTTATTTTGG + Exonic
1153231223 18:2938037-2938059 TTAAACAATTTAACTTTTTTAGG - Exonic
1153406639 18:4748172-4748194 TTATCCAAATGTGCTTTTTTAGG + Intergenic
1153566431 18:6422838-6422860 TGTTACAATTGTAATTGTTTTGG - Intergenic
1153663377 18:7346039-7346061 TTAAAAAATTGTATTTTTATAGG - Intergenic
1154059994 18:11050783-11050805 TTATATATATATAGTTTTTTAGG - Intronic
1154341639 18:13507654-13507676 TGTTACTATTGTAGTTGTTTTGG + Intronic
1155854893 18:30820741-30820763 TTCTACAATATTAGTTTTTCTGG - Intergenic
1156287995 18:35718112-35718134 TGATACTATTGTAATTGTTTGGG + Intergenic
1157055964 18:44229316-44229338 TTCTGCAATTGAAGTTTTTCAGG + Intergenic
1157089191 18:44615456-44615478 TTATCCAATCCTAGATTTTTTGG + Intergenic
1158056547 18:53286960-53286982 TTATACTATTCTTTTTTTTTTGG + Intronic
1158072174 18:53485091-53485113 TAATACAATTGTATTGTATTAGG + Intronic
1158542306 18:58368117-58368139 TTATACATTTGTATGTTTTCTGG + Intronic
1158748062 18:60225372-60225394 TTTTTCAATTGTATTTTTTGGGG + Intergenic
1159493145 18:69164357-69164379 TTAGACAAATATAGTTTTGTGGG - Intergenic
1159629168 18:70729322-70729344 TTAGACAATTGAAATCTTTTTGG + Intergenic
1160186516 18:76680515-76680537 ATAGACAGTTGTTGTTTTTTCGG - Intergenic
1160439452 18:78878230-78878252 TAATACAATTGTAATCTTTAAGG - Intergenic
1160561341 18:79758629-79758651 TTATACAAAAGTATTTTATTTGG + Intergenic
1163563494 19:18035303-18035325 ATAAACAATTGAAGTTTATTTGG - Intergenic
1163737616 19:18991026-18991048 TTAGAGAATTGTAGTGTTTTTGG - Intronic
1164881909 19:31739869-31739891 TTGTACAAGTGAAGTCTTTTAGG - Intergenic
1166907479 19:46122707-46122729 GTAAACCATTGCAGTTTTTTGGG - Intronic
1167278021 19:48550557-48550579 ATATACAATTTTATTTGTTTTGG + Intergenic
1168387066 19:55972849-55972871 TTATCCACTTGTTGTTTTATGGG + Intronic
925240952 2:2326799-2326821 TTCTACAATGGAAGTGTTTTTGG - Intronic
925479688 2:4256271-4256293 TTACACAGGTGTATTTTTTTGGG - Intergenic
926359469 2:12072255-12072277 TTATATTTTTGTACTTTTTTTGG - Intergenic
926941047 2:18137476-18137498 TTAGAAAACTGTAGTTATTTGGG + Intronic
927302428 2:21530939-21530961 TTATCCATTTGTACTTTCTTTGG + Intergenic
927330596 2:21858746-21858768 TTATAGAATTTTATTTTTTATGG - Intergenic
928669833 2:33591216-33591238 TTATACAACTTCAGTTTTTAAGG - Intronic
928766990 2:34659192-34659214 GTATATAATTGGAGTTTTTCAGG + Intergenic
928923819 2:36555484-36555506 TTATATAATTTAAGTTTTATTGG - Intronic
929378074 2:41315204-41315226 TCAAACATTTGTATTTTTTTTGG + Intergenic
930308716 2:49710619-49710641 TTGTACAACTATAGTTTTTATGG + Intergenic
930588040 2:53293340-53293362 TAATACTATTTCAGTTTTTTTGG - Intergenic
930835379 2:55787838-55787860 TTATACAATTTCTGTTTTCTTGG + Intergenic
930837183 2:55806894-55806916 TTCTTCAATTGTAATTTTCTTGG + Intergenic
931144149 2:59498292-59498314 TTAAACAATTTTGGATTTTTGGG - Intergenic
931490772 2:62744310-62744332 TTGTATAATTGTAGGTTTATTGG + Intronic
932443843 2:71759079-71759101 ATATATTATTATAGTTTTTTTGG + Intergenic
932469961 2:71948348-71948370 TGTTACTATTGTATTTTTTTGGG - Intergenic
932687748 2:73887492-73887514 TTAAAAAATTGTAATTTTTGTGG - Intergenic
932909860 2:75794303-75794325 GTAAACAATTCTAATTTTTTAGG - Intergenic
933005241 2:76984328-76984350 TTTTAAATGTGTAGTTTTTTTGG + Intronic
933642332 2:84777258-84777280 ATATAAAATTGCAGGTTTTTTGG + Intronic
935456399 2:103272980-103273002 TGATACTAAAGTAGTTTTTTAGG - Intergenic
935793472 2:106615723-106615745 TTATACAATTTTACATTTATAGG + Intergenic
935894553 2:107720448-107720470 TTATGGAAGTGTACTTTTTTGGG + Intergenic
936339945 2:111622332-111622354 TTGAACATTTGTAGTATTTTAGG - Intergenic
936818698 2:116491711-116491733 TAATAAAATTGTTGTTTTTGTGG + Intergenic
936971588 2:118181586-118181608 TTACACAATTATGATTTTTTTGG - Intergenic
937379846 2:121366833-121366855 TTGTACAATGGTGTTTTTTTCGG - Intronic
939308966 2:140447996-140448018 TAATACTATTGTAATTGTTTTGG - Intronic
939760063 2:146164111-146164133 TTATAATTTTGTAGTTTATTTGG + Intergenic
940310340 2:152272594-152272616 TTAAAAAATTGGGGTTTTTTTGG - Intergenic
940433559 2:153623367-153623389 ATATAAAATTGTAGTTTTGGTGG + Intergenic
940578091 2:155540289-155540311 TTATACATTTGTATTTTGCTTGG + Intergenic
940658226 2:156514874-156514896 TTAATCCATTGTAGTTTATTGGG + Intronic
940956505 2:159734421-159734443 TTATGCAAGTGTAGTTTTCAAGG + Intronic
941117989 2:161493700-161493722 TTATAAAATTGTTCTTTTTTGGG - Intronic
941279133 2:163528246-163528268 TTTTACAATAGGATTTTTTTTGG - Intergenic
941421582 2:165288943-165288965 TTCTACAATTGTAGTTTTTTGGG - Intronic
941519235 2:166518482-166518504 CTAGACAATTATAGTTTTCTTGG - Intergenic
941864569 2:170321244-170321266 TTTTAAAATTGTAATTTCTTGGG - Intronic
941957416 2:171218935-171218957 TTAAAAAATTGTGGGTTTTTTGG - Intronic
942625102 2:177892248-177892270 TTATAAAATTATATTTTTATAGG + Intronic
942951891 2:181730707-181730729 ATATACAATTCTTGTTTTTGAGG - Intergenic
943285846 2:185998997-185999019 TGTTACTATTGTAGTTGTTTTGG + Intergenic
943295337 2:186131168-186131190 TTATACATTTTTTTTTTTTTTGG + Intergenic
943411011 2:187547904-187547926 TCATTCAATTGTAATTTTCTGGG + Intronic
943488894 2:188524214-188524236 TTATTCAATTGAATTTTTTTTGG - Intronic
943805887 2:192125089-192125111 TCATACAAGTGTTGTTGTTTGGG - Intronic
944098895 2:196000552-196000574 TTGGAAAATGGTAGTTTTTTAGG + Intronic
944153481 2:196587194-196587216 TTATACTATTGAAGTTTTCTAGG - Intronic
944230528 2:197387488-197387510 TTATAAAAATGCAGTTTTTTGGG + Intergenic
945550382 2:211214152-211214174 TTATGCATTTGTTGTCTTTTTGG - Intergenic
946234259 2:218313102-218313124 TTATACAATTTTTTTTTTTTTGG + Intronic
946816945 2:223588640-223588662 TTACAAAATTATAGTTATTTTGG - Intergenic
947197133 2:227579407-227579429 GTATCTAATTATAGTTTTTTTGG + Intergenic
947325391 2:228968885-228968907 TTATACAATTTCAGCTATTTAGG + Intronic
947554025 2:231073199-231073221 TGTTACCATTGTAGTTGTTTTGG - Intronic
948978635 2:241480594-241480616 TTATACTTTTATACTTTTTTAGG + Intronic
1170310748 20:14989125-14989147 ATATAGAATTTTAGCTTTTTTGG + Intronic
1174441160 20:50555770-50555792 TTATGCATATGTACTTTTTTTGG - Intronic
1176545795 21:8197721-8197743 TTATTTATTTGTAGTTTTTGAGG + Intergenic
1176564746 21:8380766-8380788 TTATTTATTTGTAGTTTTTGAGG + Intergenic
1176883576 21:14227909-14227931 TTATACAATTGTGTATTTATAGG + Exonic
1176936586 21:14874915-14874937 CTATACAATTGTTGCTATTTTGG + Intergenic
1177215929 21:18128534-18128556 GTATACAATTGTACTTTCTTTGG - Intronic
1177689120 21:24480881-24480903 TCACAAAATTGTAATTTTTTGGG - Intergenic
1178279672 21:31270715-31270737 TTTTGCAATTTTGGTTTTTTTGG + Intronic
1178398432 21:32262940-32262962 CTATAGAGTTGTAGTTTCTTTGG - Intergenic
1178686906 21:34719025-34719047 TTACACACATGTAGGTTTTTAGG - Intergenic
1180991194 22:19937694-19937716 TTTTAACAGTGTAGTTTTTTTGG - Intronic
1181312089 22:21950466-21950488 TTTAACAACTGCAGTTTTTTAGG + Intronic
1181435634 22:22908879-22908901 TTGTAAGAATGTAGTTTTTTGGG - Intergenic
1182382135 22:29900119-29900141 TTATTAAATTGGAGGTTTTTTGG + Intronic
1183787179 22:40036505-40036527 ATAAACAATTTTAGTTTGTTTGG + Exonic
1203250666 22_KI270733v1_random:113958-113980 TTATTTATTTGTAGTTTTTGAGG + Intergenic
949173211 3:1027544-1027566 TTAATAAATTGTAGTTTATTTGG + Intergenic
951127421 3:19000191-19000213 TTATACACTTTTAATCTTTTGGG + Intergenic
951913480 3:27775469-27775491 TTATACAGTTCTACTTTTTGTGG + Intergenic
953302627 3:41794057-41794079 TGATAGAAGTGTAGTTTTTTGGG - Intronic
953486833 3:43307572-43307594 TGTTACTATTGTAGTTGTTTTGG + Intronic
954553402 3:51500252-51500274 TTCTGGATTTGTAGTTTTTTTGG + Intergenic
955667806 3:61368905-61368927 TTTTACAAATATAGTTTTATTGG - Intergenic
955866974 3:63395099-63395121 TTAAACAATTCCAGTGTTTTAGG + Intronic
955969793 3:64426967-64426989 TGTTACTATTGTAGTTGTTTTGG + Intronic
956951287 3:74286441-74286463 TTTAATAATTGTAATTTTTTAGG - Intronic
957622178 3:82607773-82607795 TGATACTACTTTAGTTTTTTTGG - Intergenic
957737624 3:84223662-84223684 TTATAAAAATGTAGTTTTAAAGG - Intergenic
957802421 3:85102667-85102689 TAAGACAATTCTAGTTTTTGAGG - Intronic
957823679 3:85412403-85412425 ATTTACAATTACAGTTTTTTGGG + Intronic
958065303 3:88537280-88537302 AAATATAAATGTAGTTTTTTGGG + Intergenic
958113326 3:89180133-89180155 CTATGCATTTGTAGATTTTTAGG - Intronic
958449087 3:94251115-94251137 TTATACAAATAAAGTCTTTTAGG + Intergenic
958517983 3:95145383-95145405 TTATTTAAATGTACTTTTTTTGG - Intergenic
958721671 3:97851500-97851522 TTCTACAATTCCAGTTTTTCAGG - Intronic
959165324 3:102769758-102769780 TAATACTATTGTAATTGTTTTGG - Intergenic
959173352 3:102871928-102871950 TTACATAATTGTAATTTTTATGG - Intergenic
959436831 3:106325593-106325615 TTACCCAATAGTAATTTTTTTGG - Intergenic
959487175 3:106940401-106940423 TAATACATTTGTATTGTTTTGGG - Intergenic
960389501 3:117059337-117059359 ATATAAAATTGTATTTTGTTTGG + Intronic
960490005 3:118305597-118305619 TTATAAAATTGTCATTTCTTGGG - Intergenic
960514167 3:118584659-118584681 TGATAAATTTGTAGTTTTTGAGG + Intergenic
961399983 3:126633061-126633083 TTATCCTATTATATTTTTTTAGG + Intronic
962213173 3:133496408-133496430 TTATAAACTTGATGTTTTTTGGG - Intergenic
963642183 3:147874503-147874525 ATATAAAATTGTAATTTTCTTGG - Intergenic
964909393 3:161760082-161760104 TGATACTATTGTAATTGTTTTGG + Intergenic
965056980 3:163732223-163732245 TAATACAATTAGAGTTTTTAAGG + Intergenic
965170808 3:165262035-165262057 TTATATGATTGCAGTTTATTTGG + Intergenic
965213141 3:165822330-165822352 TTAAACAATTGTACTTTTTTTGG + Intronic
965226088 3:165993051-165993073 TAATCCATTTATAGTTTTTTGGG - Intergenic
965342686 3:167510082-167510104 TAATAAAAATGTAGTATTTTTGG + Intronic
965461222 3:168966623-168966645 TTATAAATTGGTAGATTTTTGGG + Intergenic
965664394 3:171077183-171077205 TTATACCATTTTATTTTTCTTGG + Intronic
965833239 3:172821743-172821765 ATACACAATTGTTATTTTTTTGG + Intergenic
966091896 3:176148291-176148313 TGATAAAGTTGGAGTTTTTTTGG + Intergenic
966515568 3:180817097-180817119 TTATACAATTCCATTTTTCTTGG + Intronic
966637300 3:182149999-182150021 ATATGCTATTGTAGTTTTTCAGG + Intergenic
966756100 3:183372876-183372898 TTATACAAATGTTGATTTGTAGG + Intronic
968732835 4:2278877-2278899 GTATTTAATTGTAATTTTTTTGG - Intronic
969290524 4:6236190-6236212 TCATACATTTGCAGTTCTTTGGG - Intergenic
969797859 4:9540121-9540143 TTATACAAATAAAGTTTTATTGG + Intergenic
970067060 4:12107828-12107850 TGATCAATTTGTAGTTTTTTTGG + Intergenic
970683730 4:18540965-18540987 TTATAAAATTATAGGTTATTTGG - Intergenic
971876288 4:32313133-32313155 TTTTACAGCTTTAGTTTTTTAGG + Intergenic
971881693 4:32382957-32382979 TTTTACAAGTGTAGTCATTTTGG + Intergenic
972887255 4:43508021-43508043 TCATACAATTGTAATTTTGAGGG + Intergenic
972975355 4:44627570-44627592 ATATTCAATTGGAGTTTTTGGGG + Intronic
973896373 4:55417677-55417699 TCACATAAATGTAGTTTTTTTGG + Intronic
974213565 4:58815325-58815347 TAATTAAATTGTAGTTGTTTTGG + Intergenic
974542306 4:63252929-63252951 TTAAAATATTGTATTTTTTTAGG + Intergenic
974588653 4:63916228-63916250 TTATACAAGTTCAATTTTTTTGG + Intergenic
974632279 4:64508657-64508679 TTAGTCATTTGTATTTTTTTTGG - Intergenic
975859410 4:78660276-78660298 TTATACAACTGTAATATGTTTGG - Intergenic
976240501 4:82950982-82951004 TTATACAAATTCAGTGTTTTTGG - Intronic
977000460 4:91492380-91492402 TTATACAATTGTAGTTTTTTTGG - Intronic
977569925 4:98618443-98618465 TTATACAAATGTAATTGCTTGGG - Intronic
977700525 4:100016934-100016956 TTTTAAAATTGTAGTTTGCTTGG - Intergenic
977715133 4:100173639-100173661 TCTTACTATTGTAATTTTTTGGG - Intergenic
979155463 4:117382951-117382973 TTTTAAAATGGTAATTTTTTTGG - Intergenic
979476997 4:121169899-121169921 TTATATACTTTTAGTTTTTAGGG + Intronic
979673966 4:123390664-123390686 TTGTACAGTTGTAGTATTATTGG + Intergenic
979717536 4:123859462-123859484 TTTTAAAATTGTTGTTATTTAGG + Intergenic
980518241 4:133893723-133893745 TTTTAAAACTATAGTTTTTTTGG - Intergenic
980918121 4:139053605-139053627 TTAAGCAATTATGGTTTTTTGGG + Intronic
981464424 4:145051334-145051356 TGATACTATTGTAATTGTTTTGG - Intronic
982406421 4:155025131-155025153 TTATACAATGATTTTTTTTTTGG + Intergenic
983127013 4:163965999-163966021 TTATAAAATTTAAGTATTTTTGG + Intronic
983350501 4:166581810-166581832 TTAAACAATTGCATTTCTTTTGG + Intergenic
983366520 4:166797871-166797893 TTATAAAATGATAATTTTTTAGG + Intronic
984076456 4:175187279-175187301 TTATTCTAATGTAGCTTTTTTGG - Intergenic
984472957 4:180200622-180200644 TTATTCAACTGAAGTTTTTGGGG + Intergenic
985088071 4:186334743-186334765 TGATACTATTGTAATTGTTTGGG + Intergenic
985499096 5:230100-230122 TCATACAATTATCCTTTTTTTGG - Intronic
986118819 5:4810056-4810078 TTTTAAAAATGTAATTTTTTTGG - Intergenic
986724917 5:10587541-10587563 TGATACAATTTTTTTTTTTTTGG + Intronic
986846010 5:11754408-11754430 TTATTCTGTTGTGGTTTTTTGGG + Intronic
986912317 5:12573898-12573920 TCAAACAATTTTAGTTTCTTAGG - Intergenic
987420796 5:17718045-17718067 TTGTGCAATTGCAGTTGTTTGGG + Intergenic
987626238 5:20404633-20404655 TGTTACTATTGTAATTTTTTTGG - Intronic
988469520 5:31525696-31525718 TTATAGCATTTGAGTTTTTTTGG - Intronic
988945569 5:36193833-36193855 TTATACAATTTGAGTCTTGTGGG - Intronic
989658635 5:43773637-43773659 TTATTCAATAGTAATTCTTTGGG + Intergenic
990391381 5:55325302-55325324 ATATGCAAGTGTTGTTTTTTTGG + Intronic
990697500 5:58436988-58437010 TGTTACTATTGTAATTTTTTGGG - Intergenic
990699775 5:58461659-58461681 TTTTACAAATGGAGTTTTGTGGG + Intergenic
990766708 5:59191943-59191965 TCATACAAGTGTAAATTTTTTGG + Intronic
990991359 5:61687384-61687406 TTATACAGTTGTAATTTCTAGGG - Intronic
991011993 5:61892757-61892779 TAATTCATTTTTAGTTTTTTGGG - Intergenic
991071939 5:62492886-62492908 TTTTAAAATTGCAATTTTTTGGG + Intronic
991152838 5:63391766-63391788 TGATACAATTCTAGTAATTTAGG + Intergenic
991279574 5:64896843-64896865 TTTGACAAACGTAGTTTTTTAGG - Intronic
991609845 5:68438752-68438774 TTACAAAAATGTAGATTTTTTGG + Intergenic
992917079 5:81467134-81467156 TTATCCAATTGGAGTTATGTAGG - Intronic
992966754 5:82010256-82010278 TAATACAATTGTGATTATTTTGG + Intronic
993026147 5:82649043-82649065 TTATGAAATTATAGTATTTTTGG + Intergenic
993283966 5:85965443-85965465 TTCTACATTTCTAGTTATTTAGG - Intergenic
994090401 5:95804853-95804875 TTATACAGTTGTCGTTGCTTGGG + Intronic
994155591 5:96500088-96500110 TGCTACTATTGTAATTTTTTTGG - Intergenic
994201172 5:96978139-96978161 TCATACAATTTTAGTTTTTAAGG - Intronic
994257864 5:97621568-97621590 TTATGCAATTGTATGGTTTTGGG + Intergenic
994615930 5:102104407-102104429 TTTTACTTTTCTAGTTTTTTAGG + Intergenic
995009157 5:107238725-107238747 TTATATCATTGTAGATGTTTGGG - Intergenic
995166436 5:109048892-109048914 CTATACAATTCTACTTTTTTTGG + Intronic
995616088 5:113965910-113965932 TTTTTCAATTTTGGTTTTTTGGG + Intergenic
995781756 5:115784088-115784110 TTATATAATTTTGGGTTTTTTGG - Intergenic
996227842 5:121022982-121023004 TTACTCATTTTTAGTTTTTTTGG + Intergenic
996507709 5:124286890-124286912 TTAAACAATTGCATTTCTTTTGG + Intergenic
996741433 5:126802844-126802866 TTATAAAATTATAGTTCATTTGG - Intronic
997491668 5:134282545-134282567 TTTCACAATTGGAGTTTTTCAGG + Intergenic
997609445 5:135204650-135204672 TTTTAAAATTTTATTTTTTTAGG + Intronic
998207892 5:140172384-140172406 TTAAACCATTGTATTTTTATTGG - Intergenic
999011517 5:148046595-148046617 TTCTACATTTTTAGTATTTTAGG - Intronic
999183008 5:149683253-149683275 TAATACAAAGGTAATTTTTTTGG - Intergenic
999214084 5:149917142-149917164 TTATACAATTTTGTTTTTCTAGG + Intronic
999632240 5:153583092-153583114 TTAGCTAATTGTAGTATTTTTGG + Intronic
1000504610 5:162099681-162099703 TTATAACATTGTAGTCATTTTGG + Intronic
1000559576 5:162768924-162768946 TTATACTATTCTAGTTCTTTAGG - Intergenic
1000669019 5:164036942-164036964 TTATACAACTGTATTTTTGAAGG - Intergenic
1000690229 5:164308752-164308774 TTATAGAATTATATTTTATTAGG + Intergenic
1000841007 5:166218337-166218359 TTAGACAAATTTAGTTTTTCAGG + Intergenic
1001375652 5:171254655-171254677 GTAAACCATTGCAGTTTTTTTGG + Intronic
1001458877 5:171890654-171890676 TTATATACCTGTAGGTTTTTTGG - Intronic
1002352660 5:178594017-178594039 TTATACAGTTTTTTTTTTTTTGG - Intergenic
1002550304 5:179984506-179984528 TCATACAGTTTTAGCTTTTTTGG + Intronic
1002763657 6:220616-220638 TTATAATATTGTGGTTTTGTAGG - Intergenic
1002970595 6:2014078-2014100 ATATAAAATTTTAGTTTGTTGGG - Intronic
1003157770 6:3610717-3610739 TTAGACAATTTTTTTTTTTTTGG + Intergenic
1003691400 6:8357678-8357700 CTCCACAAATGTAGTTTTTTTGG - Intergenic
1004060638 6:12194318-12194340 TTATAAAATTTTAGTTCTTCAGG + Intergenic
1005337196 6:24809113-24809135 TTATACATTTATTCTTTTTTGGG - Intronic
1005512491 6:26522967-26522989 TCATAGAAATGTTGTTTTTTGGG + Intergenic
1005741707 6:28797221-28797243 TTATACATATGTAATTTTATAGG + Intergenic
1005877623 6:30024748-30024770 TTAAACATTTGCAGTGTTTTTGG - Intergenic
1008152345 6:47969628-47969650 TTATGCAATTTTATTTTTTGGGG - Intronic
1008337991 6:50329489-50329511 TTATACAAGTGTATTTATCTTGG - Intergenic
1008679024 6:53852797-53852819 TTATTCACTAGTAGTTTTATGGG - Intronic
1008762692 6:54872318-54872340 TTATACAATTGCATTTTGTAAGG + Intronic
1009985980 6:70781862-70781884 TTATACAATTGTAGTGTTCTGGG + Intronic
1010569415 6:77460050-77460072 TTATACAGTTGTATTTTCTTTGG - Intergenic
1010695610 6:78970794-78970816 TTATGCCATGGTTGTTTTTTGGG + Exonic
1010862629 6:80932164-80932186 TTATTCAATTGTTGATTGTTGGG + Intergenic
1010984522 6:82408310-82408332 TTAGACAATTTTAGTTGTATTGG - Intergenic
1011120668 6:83948628-83948650 TTGTAAAATTTTATTTTTTTAGG + Intronic
1011170057 6:84495555-84495577 TAAGGCAATTGTAGTTTTTTAGG - Intergenic
1011178673 6:84593782-84593804 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1011231689 6:85168998-85169020 TAATACATTGGAAGTTTTTTTGG - Intergenic
1011638025 6:89392654-89392676 TTAGACAATTGTAGAGTTTTGGG - Intronic
1012012714 6:93810641-93810663 TGATACTATTGTAATTGTTTTGG + Intergenic
1012302512 6:97606770-97606792 TTTTAAAATTATAGGTTTTTGGG + Intergenic
1012711485 6:102612242-102612264 TTATACATTTGTTGTTTTTATGG - Intergenic
1013307343 6:108861821-108861843 TAATATTACTGTAGTTTTTTGGG + Intronic
1013375344 6:109509355-109509377 ATATTCACTTGTAATTTTTTTGG + Exonic
1014417702 6:121204214-121204236 TGCTACTATTGTAGTTCTTTGGG - Intronic
1014466811 6:121765792-121765814 TTATACACTTATAAGTTTTTTGG + Intergenic
1014587803 6:123222348-123222370 TTATATAAATGCAGATTTTTAGG + Intronic
1014593493 6:123302961-123302983 TTATATGTTTATAGTTTTTTAGG + Intronic
1014889161 6:126821159-126821181 TTATAAAATTATACTTTTCTTGG - Intergenic
1015130102 6:129799640-129799662 AAATACATGTGTAGTTTTTTAGG + Intergenic
1015250535 6:131123348-131123370 TTATTCAGTTTTGGTTTTTTTGG + Intergenic
1015661922 6:135585025-135585047 ATATACAGTGGTGGTTTTTTTGG - Intergenic
1015795428 6:137006517-137006539 AAATACAATTATAGTTTATTAGG - Intronic
1015951828 6:138561187-138561209 TTGTACACTTGTAGTATTGTAGG - Intronic
1015996887 6:139004166-139004188 TTTTACCAAAGTAGTTTTTTTGG + Intergenic
1016073857 6:139773374-139773396 GTATAAAATTGTAATTATTTGGG - Intergenic
1016167064 6:140959461-140959483 TTGTTGAATTGTTGTTTTTTTGG - Intergenic
1016608906 6:145965552-145965574 TGTTACTATTGTAGTTTTTTGGG + Intergenic
1016663993 6:146613360-146613382 TTACACAATTGAATTATTTTGGG - Intronic
1017461043 6:154650750-154650772 TTTTACTATTGTAATTATTTTGG - Intergenic
1017804376 6:157930926-157930948 TTTTACAATTGCATTTTTTAAGG + Intronic
1018130623 6:160729353-160729375 GAATAGAATTGCAGTTTTTTGGG - Intronic
1018277459 6:162148131-162148153 TTATCCAATGGTTGTTTTATAGG - Intronic
1018383715 6:163284192-163284214 TTATAAAACTGTAGGTTTTCTGG + Intronic
1018547696 6:164956327-164956349 TTATACAATGAAAGTCTTTTAGG - Intergenic
1019203409 6:170339322-170339344 TTATAAAATTGAAGTTTTAAGGG + Intronic
1019651961 7:2164649-2164671 TTCTACAATTGATTTTTTTTTGG - Intronic
1020674005 7:11157595-11157617 TTCTTCAACTGTAGTTTCTTTGG - Intronic
1020765066 7:12309068-12309090 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1020858285 7:13455821-13455843 TTATCAAATTGTAGTTTTAATGG + Intergenic
1021204473 7:17763464-17763486 TGTTACAATTGCAGTTGTTTTGG - Intergenic
1021204896 7:17768322-17768344 TTATACAATGGAATTTTATTTGG - Intergenic
1021384555 7:20012324-20012346 TAATACTGTTGTAGTTTTTTTGG + Intergenic
1022166376 7:27767136-27767158 ATATAACACTGTAGTTTTTTAGG - Intronic
1022275387 7:28849530-28849552 TTATCCATTTGTACTGTTTTGGG - Intergenic
1022297957 7:29074495-29074517 TTATTCAATGATAGTTTATTGGG + Intronic
1023093647 7:36639211-36639233 TTATACAATAGGAGAATTTTAGG - Intronic
1023095779 7:36658353-36658375 TTCTTGAATTGTAGTTTTTCTGG - Intronic
1026885435 7:73939929-73939951 TTATAGCAATGTAGTTTTGTGGG + Intergenic
1027917657 7:84346676-84346698 TGTTACTATTGTAGTTGTTTTGG - Intronic
1028051573 7:86194540-86194562 TTATATTATTGTTGTTGTTTAGG + Intergenic
1028056612 7:86252876-86252898 TTATGCATTTCCAGTTTTTTAGG - Intergenic
1028290172 7:89055980-89056002 TAAGACAATTGTATTTCTTTTGG + Intronic
1028479708 7:91291612-91291634 TTCTACAAGTGTAATTTGTTGGG + Intergenic
1028575076 7:92339970-92339992 TCAGAAAATTCTAGTTTTTTTGG + Intronic
1028721291 7:94034973-94034995 TTATCCTATTGTAGTTTGATTGG + Intergenic
1028769541 7:94601664-94601686 TTTTTCAAGTGGAGTTTTTTGGG - Intronic
1028797628 7:94922070-94922092 TAATAAAATTATATTTTTTTAGG - Intronic
1030350179 7:108476118-108476140 CTATAAAATTGTTGTTTTTGTGG + Intronic
1030444959 7:109637918-109637940 TAACACAATTGTATTTCTTTTGG + Intergenic
1030620668 7:111786964-111786986 TTATACTTTTGTTGATTTTTAGG - Intronic
1031345714 7:120663462-120663484 TTAAAAAATTGAAGTTTTTAAGG - Intronic
1031719381 7:125152049-125152071 TTATGCTATGGTAATTTTTTTGG - Intergenic
1031932159 7:127696553-127696575 TTATGGAATTGAAATTTTTTAGG - Intronic
1032316417 7:130842639-130842661 TTCTGCAATTTTACTTTTTTTGG + Intergenic
1032438813 7:131925315-131925337 ATATAAAATTGTCATTTTTTAGG + Intergenic
1033298367 7:140161963-140161985 TTATACCATTGTAGATAATTTGG - Intronic
1033893890 7:146047821-146047843 TTATTTTATTGTTGTTTTTTCGG + Intergenic
1034079861 7:148266556-148266578 GTAAACAGTTGTAGTTTTCTCGG - Intronic
1034727504 7:153351696-153351718 TGTTACTATTGTAGTTGTTTTGG + Intergenic
1034893647 7:154860953-154860975 TTTTACATTTTTAGTCTTTTTGG - Intronic
1034914878 7:155029054-155029076 AAAAAAAATTGTAGTTTTTTGGG + Intergenic
1034989649 7:155540125-155540147 TAAGACAATTGTATTTCTTTTGG + Intergenic
1035761840 8:2074384-2074406 TTATAACTTTGTAGTGTTTTTGG + Intronic
1036983404 8:13497323-13497345 TCACATAATTGTAGTTTTCTAGG + Intronic
1037019707 8:13954898-13954920 TGTTACTATTGTAGTTCTTTTGG - Intergenic
1037414537 8:18635458-18635480 TTAGACAATGGGATTTTTTTTGG - Intronic
1037792174 8:21955005-21955027 TTATAAAAATGCAGTTTTTAGGG + Intronic
1039041631 8:33414090-33414112 TAAGACAATTGTATTTCTTTTGG - Intronic
1039065924 8:33607398-33607420 TAAGACAATTGCATTTTTTTTGG + Intergenic
1039076806 8:33697881-33697903 TGTTACTATTGTAGTTGTTTTGG - Intergenic
1039324861 8:36474242-36474264 TTATTCTATTGCAGTTTTTCTGG + Intergenic
1039625950 8:39053335-39053357 TTATAAACTTGTAATTTTATCGG + Intronic
1039675193 8:39656245-39656267 TTATAAAATTATAGTTATTAAGG + Intronic
1040760729 8:50839524-50839546 TGATACATTTAAAGTTTTTTTGG - Intergenic
1040973946 8:53169554-53169576 TTATAGAAATGAAGTTTTCTGGG + Intergenic
1041560131 8:59208319-59208341 TCACACAATTGTTGTTTTTCAGG - Intergenic
1042547574 8:69964783-69964805 TTATTTAATTTTAATTTTTTTGG - Intergenic
1043156380 8:76786625-76786647 TTATACATTTCTTATTTTTTGGG - Intronic
1043345331 8:79291527-79291549 TAATAAAATTGTATTGTTTTAGG + Intergenic
1043700155 8:83276685-83276707 TTACACTAATGTAGTCTTTTGGG + Intergenic
1043945745 8:86250441-86250463 GTATACATTTGTATGTTTTTTGG + Intronic
1044184091 8:89231460-89231482 TTATAAAATTGTAGCCTTTATGG - Intergenic
1044228986 8:89752725-89752747 TCTTAAATTTGTAGTTTTTTAGG + Intergenic
1044652104 8:94507079-94507101 TTATTCATTTGTATCTTTTTTGG + Intronic
1044756123 8:95463045-95463067 TTTTAAAATTGTAGTTGTTCTGG + Intergenic
1044826356 8:96201560-96201582 TTAAACAGTTGTAGCTCTTTGGG + Intergenic
1045081335 8:98629022-98629044 TTGTACAGTGATAGTTTTTTAGG + Intronic
1045899245 8:107255975-107255997 TTGTACAGTTGTACTTATTTGGG - Intronic
1046179358 8:110623255-110623277 ATATAAAATTCTAGTTTTCTGGG + Intergenic
1046304846 8:112352728-112352750 CTATACAATTTTAATTTTTATGG + Intronic
1046305526 8:112360124-112360146 TGGTACAATTTTAGTTTCTTGGG + Intronic
1046522955 8:115348908-115348930 TTAAACCATTATACTTTTTTTGG - Intergenic
1046738514 8:117803757-117803779 TTATACAATTTTAGTATTAAAGG - Intronic
1046803878 8:118459062-118459084 TCAAACAATTGTTTTTTTTTTGG + Intronic
1046927690 8:119809806-119809828 TATTACAATTGTAATTGTTTTGG - Intronic
1047385457 8:124405146-124405168 TCAAACAATTGTAGGTTTTGAGG - Intergenic
1048871221 8:138800903-138800925 TCATACACATGTGGTTTTTTAGG - Intronic
1050032650 9:1402707-1402729 TTGTACAATGCTAGTTTTATAGG + Intergenic
1050149294 9:2603118-2603140 TTAAAAAAATGAAGTTTTTTAGG - Intergenic
1050839234 9:10125929-10125951 TTATGCATTTTTAGTTTTCTTGG - Intronic
1051085694 9:13346467-13346489 TTTTAAAATTGTATTTCTTTGGG + Intergenic
1051244448 9:15095529-15095551 TTATACAATGGTAGCCTTTTGGG + Intergenic
1051760200 9:20454877-20454899 TTGTTCATTTGTATTTTTTTTGG - Intronic
1051853335 9:21534728-21534750 TCTTAAAATTGAAGTTTTTTGGG - Intergenic
1051977639 9:22971476-22971498 TAATAAAATTGAATTTTTTTAGG - Intergenic
1051989347 9:23132570-23132592 TTATACAATTGGCATTTATTAGG - Intergenic
1052165705 9:25325102-25325124 TTATACATTTGCAATTTTGTAGG - Intergenic
1052549617 9:29931139-29931161 TTAAACAATAGTAGTTTATTTGG - Intergenic
1052740784 9:32390927-32390949 TTATTCAGTTGTATTTTTTCAGG - Intronic
1053330849 9:37205860-37205882 TTGTACAATTGTGGATTTGTTGG + Intronic
1056784225 9:89577906-89577928 ATATATAGTTCTAGTTTTTTGGG + Intergenic
1058254969 9:102750333-102750355 TTATCCAATAGTAATTCTTTAGG + Intergenic
1058324506 9:103678858-103678880 TTTTTAAATTGTAATTTTTTAGG + Intergenic
1058424389 9:104863971-104863993 TTATTCAAATGTAGATTTGTAGG - Intronic
1059094432 9:111397545-111397567 TTTTACAAATGAAGTTTTTGAGG - Intronic
1203467067 Un_GL000220v1:97230-97252 TTATTTATTTGTAGTTTTTGAGG + Intergenic
1186146014 X:6624952-6624974 TTAAACATTTGTGGTTTTTTAGG + Intergenic
1186677555 X:11834862-11834884 TTTTATACTTTTAGTTTTTTTGG + Intergenic
1186953317 X:14652618-14652640 TTTTACTATTATAATTTTTTGGG + Intronic
1187566768 X:20458241-20458263 TTATTTAATTTTAGTTTTTTTGG + Intergenic
1187999282 X:24964425-24964447 TTATACAATTCAAGATTTCTAGG - Intronic
1188093904 X:25998751-25998773 CTATACATTTGTATTTTTTCAGG + Intergenic
1188193799 X:27205927-27205949 TTAATCAATTATAGTTTATTTGG + Intergenic
1188732640 X:33670103-33670125 TTTTACTATTGTAATTGTTTTGG + Intergenic
1189026070 X:37395913-37395935 TTATACAGTGGTATTTTGTTTGG + Intronic
1189520204 X:41758892-41758914 TTTACCAATTGTAGTTCTTTTGG + Intronic
1189711765 X:43820050-43820072 TTATACATTTTGAGTTATTTAGG + Intronic
1190787170 X:53662924-53662946 TTATTGTATTGTATTTTTTTTGG - Intronic
1190806530 X:53843315-53843337 TTTTAAAATTGGAGTTTTGTTGG - Intergenic
1191008141 X:55732926-55732948 TTATTCACTTGTAATTTTGTGGG + Intronic
1191790451 X:64966697-64966719 TTATACAAATGTGGCCTTTTGGG - Intronic
1192618984 X:72657770-72657792 TTATATTATTATAGGTTTTTTGG - Intronic
1192674347 X:73180037-73180059 TTATACATTCGTAGTTACTTAGG - Intergenic
1193405445 X:81095313-81095335 TTATAATTTTGTAGGTTTTTGGG - Intergenic
1193926766 X:87496530-87496552 TTGTGTAATTGTAGTTCTTTTGG - Intergenic
1194683502 X:96883238-96883260 TTTTAAAATTGTAATTTTCTGGG - Intronic
1194957873 X:100202198-100202220 TTTTACATTTGTACTTTTTAGGG - Intergenic
1195896657 X:109752031-109752053 TTATATAATTTTTGTTTTCTAGG + Intergenic
1196547944 X:116986608-116986630 TTTTACAATTGTAATTGTTTTGG - Intergenic
1197663189 X:129195650-129195672 TTATACAATTGGCTTTTATTAGG + Intergenic
1198423290 X:136489747-136489769 TTATACAAAAGAAGTCTTTTAGG + Intronic
1198793613 X:140372529-140372551 ATATAAAATTGTAGATTTTCTGG + Intergenic
1199854380 X:151748240-151748262 TTATAAAATTGTAGTTTCAAGGG - Intergenic
1200807178 Y:7444918-7444940 TTTTACTACTGTTGTTTTTTAGG + Intergenic
1202594125 Y:26519399-26519421 TATTACTATTGTAGTTGTTTTGG + Intergenic