ID: 977000465

View in Genome Browser
Species Human (GRCh38)
Location 4:91492429-91492451
Sequence AGCACTGCTGTCTCTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977000460_977000465 26 Left 977000460 4:91492380-91492402 CCAAAAAAACTACAATTGTATAA 0: 1
1: 1
2: 3
3: 33
4: 579
Right 977000465 4:91492429-91492451 AGCACTGCTGTCTCTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977000465 Original CRISPR AGCACTGCTGTCTCTTCCCA GGG Intronic
No off target data available for this crispr