ID: 977004463

View in Genome Browser
Species Human (GRCh38)
Location 4:91547530-91547552
Sequence AAAAGTAAACAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2271
Summary {0: 1, 1: 1, 2: 19, 3: 201, 4: 2049}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977004463_977004465 7 Left 977004463 4:91547530-91547552 CCTTCTTCCTTCTGTTTACTTTT 0: 1
1: 1
2: 19
3: 201
4: 2049
Right 977004465 4:91547560-91547582 ATGTGCCTTCATATTTAAAATGG 0: 1
1: 5
2: 16
3: 108
4: 628
977004463_977004466 8 Left 977004463 4:91547530-91547552 CCTTCTTCCTTCTGTTTACTTTT 0: 1
1: 1
2: 19
3: 201
4: 2049
Right 977004466 4:91547561-91547583 TGTGCCTTCATATTTAAAATGGG 0: 1
1: 7
2: 32
3: 181
4: 909

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977004463 Original CRISPR AAAAGTAAACAGAAGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr