ID: 977005322

View in Genome Browser
Species Human (GRCh38)
Location 4:91561489-91561511
Sequence AATGACTACATGAGGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977005322 Original CRISPR AATGACTACATGAGGGATCA GGG (reversed) Intronic
903627219 1:24740036-24740058 AATGACTGGATGGGGGAGCAGGG - Intergenic
907251226 1:53141282-53141304 AATGACTACAGGAGACATCAGGG - Intronic
909138515 1:71832793-71832815 CATGATTACATAAGGAATCATGG + Intronic
911581895 1:99643926-99643948 AATGACTGTATGAGAGAACATGG + Intergenic
917379147 1:174384271-174384293 ATTGACTACAAGAGGGTCCAGGG + Intronic
1068701145 10:60021288-60021310 AATAAATAAATGAGGGATGAAGG + Intergenic
1068748366 10:60561983-60562005 AAGGAATACATGAGTGAACATGG - Intronic
1070671615 10:78381371-78381393 AATGGCTCCAAGAAGGATCATGG - Intergenic
1079323273 11:19470146-19470168 AACACCTACATGAGTGATCAGGG - Intronic
1080267477 11:30416773-30416795 ACTGAGTAGATGTGGGATCAGGG + Intronic
1083881782 11:65552505-65552527 AGAGACCACATGGGGGATCAAGG - Intronic
1086602578 11:88652742-88652764 AATGAATACATGAGTGTTGAAGG - Intronic
1090829604 11:130411679-130411701 AATGACTAGATGAGGAAGCCAGG - Intronic
1092260161 12:6949127-6949149 AATGACCACAGACGGGATCAGGG - Intronic
1093416764 12:18929149-18929171 AATGACCACAAGAGGGTTCATGG - Intergenic
1096872796 12:54604674-54604696 TGTGACTACAAGAAGGATCATGG - Intergenic
1097387035 12:58962415-58962437 AATGACTACACGTGGTATTAAGG + Intergenic
1098310045 12:69139551-69139573 AATTCCTACCTGAGGGATCTAGG + Intergenic
1098397406 12:70035143-70035165 AATGACTACATTAGAAAACAGGG + Intergenic
1100250891 12:92822356-92822378 AATGAGTAAATGAGAGATGAGGG - Intronic
1100967838 12:100032319-100032341 AATGAATGGATGAGGTATCAAGG - Intronic
1103234276 12:119359389-119359411 AATGACTACATAAAGGGTCTTGG - Intronic
1104315917 12:127701254-127701276 AATGATTACAAGTGGAATCATGG + Intergenic
1104518251 12:129448063-129448085 AATGAATGCATGAGGGAATATGG + Intronic
1105385713 13:19927478-19927500 AATGAACACAGCAGGGATCACGG - Intergenic
1105603259 13:21906180-21906202 AATGAATTCATAAGGGATTATGG - Intergenic
1106348212 13:28900392-28900414 AAGGGCAACATGAGGGATCCTGG - Intronic
1106822583 13:33482254-33482276 AATGTGTACGTGAGGGTTCATGG + Intergenic
1107030415 13:35845822-35845844 AATGACCACATGTGGGATAAGGG - Intronic
1108487328 13:50940266-50940288 ATTGACTACATAAGGGTTCCAGG + Intronic
1108576693 13:51797158-51797180 TATGGCTACACGATGGATCATGG + Intronic
1109410197 13:61954806-61954828 AATGGGTACATGAGGATTCATGG - Intergenic
1110572581 13:77022471-77022493 AATGTCCACATGAGGGATCTAGG + Intronic
1111479626 13:88807366-88807388 AATGACTACATGACTTACCAAGG - Intergenic
1111635543 13:90898674-90898696 AATAACAACATGAGAGATCCTGG - Intergenic
1111708400 13:91780381-91780403 AATGAATACATGAGGAATCTGGG - Intronic
1111854197 13:93615867-93615889 AATGACTACATGAGCTAACATGG + Intronic
1115709224 14:36031776-36031798 TTTGATTACATGAGTGATCAAGG + Intergenic
1116955651 14:50920527-50920549 AATGACAATGTGAGTGATCAAGG - Exonic
1116984873 14:51207897-51207919 AAAGCCTACATGAGGGATGTTGG - Intergenic
1118714726 14:68551040-68551062 ACTGACTGCCTGGGGGATCATGG - Intronic
1119600598 14:75973791-75973813 AGTGACTACAAGAGGAATAAAGG + Intronic
1128345102 15:66848502-66848524 AATGGCTGTATGAGGGATGAAGG + Intergenic
1130666565 15:85874340-85874362 CATGACTCCATGAGAGACCAGGG + Intergenic
1131664992 15:94560614-94560636 AATAAGAACAGGAGGGATCAAGG - Intergenic
1135335096 16:21594742-21594764 AATGCCCACGTGAGGGATCTAGG - Intergenic
1135661250 16:24298874-24298896 CATGATTACATGAAGGATCATGG + Intronic
1137315944 16:47323252-47323274 AATGAATTCATGGGTGATCATGG + Intronic
1147347231 17:39808148-39808170 AATGATTACAAGAAGCATCATGG + Intronic
1150184257 17:63163116-63163138 AATGAGAACATGAGGGGTGAAGG + Intronic
1150862989 17:68820552-68820574 AATGTTTACAAGAGGGAACATGG + Intergenic
1150871189 17:68912106-68912128 AATGACTAAATAAGGTACCAGGG + Intronic
1156820509 18:41366721-41366743 AATTACTAGATGAGAAATCAGGG + Intergenic
1157846064 18:51005089-51005111 AATGACCACAGGATGGATCCAGG - Intronic
1157999074 18:52595005-52595027 TAAGACTACCTGAAGGATCAAGG + Intronic
1159695882 18:71555084-71555106 AATGATTACAGAAGTGATCAGGG - Intergenic
1160427774 18:78790188-78790210 AATGACCTCAGGAGGGAGCAGGG - Intergenic
1163235263 19:16025990-16026012 GATGACCACATGGGGGACCATGG + Intergenic
1166941323 19:46367923-46367945 AATGACCACAGGAGGGGTCCAGG - Intronic
1167050444 19:47074844-47074866 AATGAGTACATGAGGGCGCCTGG - Intronic
929731469 2:44498007-44498029 AATAAAGACATCAGGGATCATGG + Intronic
931230230 2:60368029-60368051 AATGGCTACATGAAGGTCCATGG - Intergenic
932422597 2:71610495-71610517 AAGAACTACATGAGGAAGCAAGG - Intronic
933659233 2:84913818-84913840 AATGACAAAATATGGGATCATGG + Intergenic
936641083 2:114313504-114313526 AATGACTACAGGATGAATCCAGG - Intergenic
937263865 2:120603874-120603896 AGTGACTGAATGAGGGACCAAGG - Intergenic
937644186 2:124247874-124247896 AAAGACTACATGTAGGAACATGG + Intronic
941078936 2:161037788-161037810 AATCAAGACATGAGTGATCAGGG + Intergenic
943010463 2:182441920-182441942 AATGAATACATTAGGAATAAAGG + Intronic
945010281 2:205453987-205454009 AATGAATAAATGAGGGAGAAAGG - Intronic
947084396 2:226434914-226434936 AATGACTTTATAAGTGATCATGG + Intergenic
948666169 2:239536079-239536101 AATGACTGCATGAGGGGCTATGG - Intergenic
1170346545 20:15393132-15393154 GATGTCAACATCAGGGATCATGG - Intronic
1172694931 20:36815988-36816010 ATGGACGACATGAAGGATCATGG - Exonic
1177148785 21:17433681-17433703 AATGAATAAATGAATGATCATGG + Intergenic
1177184443 21:17778194-17778216 AATGATTTGATGAAGGATCAAGG + Intergenic
1177865395 21:26506807-26506829 AGTGACCAAATGAGGGGTCAGGG - Intronic
1178744034 21:35230456-35230478 AATGACTGCATGAGGAATAAGGG + Intronic
1179011686 21:37561478-37561500 AATGATCACATCAGGGATCCAGG - Intergenic
1181296733 22:21846230-21846252 CAAGAGTACATAAGGGATCAGGG - Intronic
949361573 3:3237780-3237802 AATAACCACATGAAGGTTCATGG - Intergenic
950547238 3:13645837-13645859 AAGGACTGGATGAGGGATGAGGG + Intergenic
951186397 3:19718733-19718755 AATGAATAAATGAAGGAACAGGG - Intergenic
951618354 3:24573355-24573377 AATTACTACATGATGTATGATGG - Intergenic
954802290 3:53194208-53194230 AATGGCTCCATGAGGGTTCTTGG - Intergenic
955802218 3:62698295-62698317 AGTTACTACATGAGGCATCCAGG + Intronic
959214597 3:103435639-103435661 AATGAATACATGAGAAATCCAGG + Intergenic
959551619 3:107665983-107666005 AAAGACTACATGAAGGTGCAAGG - Intronic
964446982 3:156769510-156769532 AATGTGTACATGTGGGATGAGGG + Intergenic
965363712 3:167772555-167772577 AATGACTACATGATGGACATCGG - Intronic
967073232 3:185980425-185980447 AATGGATAAATGAAGGATCAAGG - Intergenic
970658998 4:18263412-18263434 AATAAATACATAAGAGATCATGG - Intergenic
974720153 4:65727677-65727699 AATGACTACAAGAGAAAGCAAGG + Intergenic
977005322 4:91561489-91561511 AATGACTACATGAGGGATCAGGG - Intronic
981072124 4:140553802-140553824 AATGACTAAATGAGGGAATATGG - Intergenic
982473109 4:155817851-155817873 AATAAATAAATGAGGGATAAAGG + Intergenic
984329515 4:178297251-178297273 TATCAGTACATTAGGGATCACGG - Intergenic
985848812 5:2373726-2373748 AATGAATGAATGAGGGATGAGGG + Intergenic
986910385 5:12548648-12548670 AATGATTACATGTGGGATCTAGG - Intergenic
987489258 5:18555887-18555909 TATGACTACTTGAGGGATTGAGG + Intergenic
989756495 5:44961716-44961738 AATGACTGCATGAGGTACCCAGG - Intergenic
989760057 5:45004123-45004145 AATGACTACATGAGAATTTAAGG - Intergenic
992936346 5:81710693-81710715 AATGAATACATGAGGGCTGAGGG + Intronic
993959167 5:94275738-94275760 AAGGACTACCTGAGGGAGCAAGG - Intronic
998322288 5:141243739-141243761 TATGACAACATTTGGGATCAAGG + Intergenic
1000294723 5:159903243-159903265 AATGACTGCACCAGGAATCAGGG + Intergenic
1004164316 6:13242163-13242185 AATGGCTATCTGACGGATCAAGG - Intronic
1004771457 6:18786972-18786994 AATGACTACACTTGGGATAAAGG - Intergenic
1004866785 6:19860481-19860503 AATGACAACATCAGGTACCAAGG + Intergenic
1006503628 6:34474231-34474253 GATGACTAAATGAGGTGTCAGGG - Intronic
1007842131 6:44725228-44725250 AATGACTACAGGGGGAAACAGGG + Intergenic
1008454733 6:51696516-51696538 GATGATTACATAATGGATCAGGG - Intronic
1008891872 6:56503335-56503357 AATAACTACATCAGGGAAAATGG - Intronic
1009283767 6:61786067-61786089 ACTGATTACATGAGGTATCAGGG - Intronic
1010188850 6:73174054-73174076 AATTACTACATCTAGGATCAAGG + Intronic
1012941887 6:105424251-105424273 AAGGACTATCTGTGGGATCAGGG - Intergenic
1017605067 6:156124817-156124839 CATGACTACATGAGGAAATATGG - Intergenic
1019038236 6:169080690-169080712 CATGACTACATAAAGGTTCATGG - Intergenic
1021395394 7:20141397-20141419 AATGTATAGATGATGGATCAAGG - Intronic
1024098669 7:46006729-46006751 AATGACCACATGAGGACACAGGG + Intergenic
1024292037 7:47811869-47811891 AATGACTCCACCAGGGATGAGGG + Exonic
1030153536 7:106429079-106429101 AGTGCCTACATGAAGTATCAGGG - Intergenic
1030423887 7:109347082-109347104 AATCACTAAATGTGGGATCCAGG + Intergenic
1034035241 7:147812838-147812860 AATGAGCACATGATGGATCAAGG + Intronic
1040435935 8:47391581-47391603 AATGACTACACGAAGAATCCAGG + Intronic
1044416442 8:91945428-91945450 ACTGTGTACATGAGGGATCTAGG - Intergenic
1044470592 8:92562281-92562303 ATAGGCTACATGAGGGGTCAGGG + Intergenic
1045323417 8:101098973-101098995 AATGAATGGATGAGGGAGCATGG - Intergenic
1046605630 8:116368688-116368710 GATGAATACATGAGGGTTCAGGG - Intergenic
1047922650 8:129651417-129651439 AATGACTTCATGATGGACCCAGG + Intergenic
1048260293 8:132939418-132939440 AAAGAATGTATGAGGGATCAAGG + Intronic
1051781433 9:20692595-20692617 GATCACTACATGAGTGAGCACGG - Intronic
1055072639 9:72182813-72182835 AATGAGTACATGAGTGAGAATGG - Intronic
1055718003 9:79139839-79139861 AATAGCTACTTGAGGGATTATGG - Intergenic
1056328906 9:85505529-85505551 AATGACAACATGAGAGAAAAGGG - Intergenic
1057488261 9:95503564-95503586 AATGAATGAATGAGAGATCAAGG + Intronic
1058766150 9:108184651-108184673 AATTACCACATGAGGGAACCCGG - Intergenic
1059068550 9:111110307-111110329 AATCACTACATGAGGACTGAGGG - Intergenic
1059778247 9:117498612-117498634 AATGAATGCATGGGAGATCAGGG + Intergenic
1061087384 9:128407056-128407078 AAAGACAACATGAGGGACTATGG - Intergenic
1186146778 X:6632382-6632404 AATGACCACATGAGGACACAGGG - Intergenic
1193952525 X:87818128-87818150 AATGATAAAATCAGGGATCAGGG - Intergenic
1195901584 X:109803378-109803400 AAGGGCGACATGAGGGATCCTGG + Intergenic
1197346515 X:125330080-125330102 AATAACTACATGAGTGAGCTTGG - Intergenic
1197427855 X:126320290-126320312 GAAGACTACAAGAGGAATCATGG + Intergenic
1198053679 X:132973158-132973180 AATGACCACATGAAGGAACAAGG - Intergenic
1199783717 X:151085125-151085147 AGTGACTACTTGAGGCATCTGGG - Intergenic
1199844559 X:151681239-151681261 GATGATTATATGATGGATCATGG - Intergenic
1201446401 Y:14060951-14060973 AATGACTGGATGAGGGATCTAGG - Intergenic