ID: 977007136

View in Genome Browser
Species Human (GRCh38)
Location 4:91582011-91582033
Sequence GTTTATGTATATGCACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977007136 Original CRISPR GTTTATGTATATGCACCTCA AGG Intronic
900897235 1:5492220-5492242 TTTTATATATCTGCACATCAAGG - Intergenic
902499893 1:16903474-16903496 GTATATGTATATGCAACAAAAGG - Intronic
904734564 1:32621086-32621108 GATTTTCTATATGCACATCAAGG - Exonic
906542566 1:46599004-46599026 GCTAATGTATATGGAGCTCATGG + Intronic
906564519 1:46789182-46789204 GTTTGTGTGCATGCACATCAAGG + Intronic
906690235 1:47787744-47787766 ATTTCTGTTTATGGACCTCAGGG + Intronic
908714627 1:67056028-67056050 GTTGATTTATCTGCACCTTAGGG - Intergenic
910397231 1:86805236-86805258 GTTTATGGTTCTGGACCTCAAGG - Intergenic
911774812 1:101795325-101795347 TTTTATGAATATGAACCTGATGG + Intergenic
914004647 1:143721631-143721653 ATTTATGTATATGCAACAAAAGG + Intergenic
914055896 1:144167131-144167153 GTATATATATATACACCCCAAGG + Intergenic
914096463 1:144548216-144548238 ATTTATGTATATGCAACAAAAGG + Intergenic
914302047 1:146385724-146385746 ATTTATGTATATGCAACAAAAGG - Intergenic
914358264 1:146907545-146907567 GTTTCTATACATGCACATCAAGG - Intergenic
914495161 1:148189462-148189484 GTTTCTATACATGCACATCAAGG + Intergenic
915085151 1:153381859-153381881 TTTTATGTCTATGCTCATCAGGG - Intergenic
915710381 1:157892436-157892458 GATTATTTATATACACCTGAAGG + Intronic
916103559 1:161413287-161413309 GTTTGTGTACATGCACATCAAGG + Intergenic
917190190 1:172408623-172408645 CTTTACTTATATTCACCTCATGG + Exonic
918290162 1:183099646-183099668 GTGAATGTTTGTGCACCTCAGGG + Intronic
919649375 1:200131031-200131053 GCTGATATATATGCACCTGAGGG + Intronic
923116682 1:230946954-230946976 GTTTATTTCTGTGCACCTAATGG - Intronic
924047831 1:240050586-240050608 GTTTTTGTATGTGAACATCATGG - Intronic
1066111911 10:32204990-32205012 GTTTTTGCATATGCAGCTAATGG + Intergenic
1066635322 10:37493981-37494003 GTTTGTATACATGCACATCAAGG + Intergenic
1067214570 10:44291919-44291941 GTATAAGTATCTGGACCTCATGG + Intergenic
1068069389 10:52177422-52177444 GTTTATGTCTATGTTCATCAGGG + Intronic
1070505481 10:77109194-77109216 TTTTATCTATAGGCACCTCACGG + Intronic
1073769944 10:106725233-106725255 GTTTATGTATATGGAACCCATGG - Intronic
1075975864 10:126694267-126694289 GTGTGTGTGTATGCACCTAATGG - Intergenic
1080984731 11:37448085-37448107 GTTTATGTATAAGAACATCTTGG - Intergenic
1081267750 11:41047853-41047875 GTGTGTGTATATACACATCAAGG - Intronic
1083394732 11:62382429-62382451 GTTTGTATACATGCACATCAAGG - Intronic
1085592093 11:77773027-77773049 GTTTCTGTCTATGCACCTTGAGG + Intronic
1086290983 11:85308964-85308986 GAGTAAGTATATGCATCTCATGG - Intronic
1095682908 12:44999576-44999598 GTTAATAAATATGCACCCCATGG + Intergenic
1097085266 12:56463228-56463250 ATATATGGATATGCATCTCAAGG - Intronic
1098688773 12:73460205-73460227 GTTTATGTATCTGCAACCAATGG + Intergenic
1098875852 12:75865745-75865767 GTTTATATATATGAATGTCATGG - Intergenic
1099171659 12:79371875-79371897 GTTTAAGTATTTGCTCCTCCAGG + Intronic
1103769424 12:123309432-123309454 ATTTCTGTAAATGCATCTCATGG + Intronic
1104387167 12:128361044-128361066 GTTTGTGTTTATGAAGCTCATGG + Intronic
1105052990 12:133071593-133071615 GTATATATATATCCCCCTCAAGG - Intergenic
1108869494 13:54965491-54965513 GTTTAAATATCTGCTCCTCAGGG + Intergenic
1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG + Intergenic
1110397147 13:75043985-75044007 GTTTATGTCTATGTTCATCAGGG - Intergenic
1113225175 13:108151862-108151884 TTTTTTGTACATGCAGCTCATGG - Intergenic
1117021526 14:51575816-51575838 GTTTATAAAGATGCAGCTCATGG - Intronic
1118742078 14:68746992-68747014 GTTTATGTAAAGTTACCTCACGG - Intergenic
1119448524 14:74687651-74687673 GTTTCCTTATATGTACCTCACGG + Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1120733151 14:88024972-88024994 GTTTGTGTACATGCACATCAAGG + Intergenic
1202919314 14_KI270723v1_random:16312-16334 GTTTGTATACATGCACATCAAGG - Intergenic
1202925319 14_KI270724v1_random:18682-18704 GTTTGTATACATGCACATCAAGG + Intergenic
1125328120 15:38557509-38557531 GTTTGAGTAAGTGCACCTCATGG - Intronic
1125929255 15:43588857-43588879 ATTTATTTAGATGCACCTCTGGG + Intronic
1125942422 15:43688689-43688711 ATTTATTTAGATGCACCTCTGGG + Intergenic
1127861498 15:62997752-62997774 TTTTATTTATATCCACCTCCTGG - Intergenic
1131697138 15:94890023-94890045 GTTTTTGCATCAGCACCTCAGGG + Intergenic
1135289366 16:21222098-21222120 GTTTCTGTATGTGCACATCAAGG - Intergenic
1135712247 16:24727832-24727854 GTGTAGGTAAATGAACCTCAGGG + Intergenic
1142366234 16:89651407-89651429 ATATATATATATGTACCTCAAGG + Intronic
1145847545 17:28055002-28055024 TTTTATCTCTATGTACCTCATGG + Intronic
1146046674 17:29514185-29514207 GTTTATGTGTATGCACGCTATGG - Intronic
1149125637 17:53227876-53227898 GTTTATATATATCCACTTGAAGG + Intergenic
1155280266 18:24232150-24232172 GTTTATGCAGTTGTACCTCAAGG - Intronic
1155905992 18:31452054-31452076 GTTTATGTGAATGCACCTCCTGG - Intronic
1156755800 18:40523622-40523644 GTTGATGTATATGCACATGTTGG - Intergenic
1157457423 18:47846431-47846453 GAGAATGTATGTGCACCTCAGGG - Intronic
1161872698 19:6882571-6882593 GTTTCTGTTTATGGAGCTCATGG + Intergenic
1163920753 19:20286373-20286395 GTTTATATACGTGCACATCAAGG + Intergenic
1167867357 19:52339081-52339103 GTTTGTATACATGCACATCAAGG - Intronic
1168218591 19:54944356-54944378 GTTTATGTATGAGCACATCAAGG + Intronic
1168341759 19:55628201-55628223 GTTTATGTTTATGGACATCTGGG - Intergenic
925853730 2:8109253-8109275 GTTTATGTAAATGCAACAAAAGG + Intergenic
931664380 2:64599829-64599851 GTTTATGCATGAGCCCCTCAGGG + Intergenic
932550313 2:72763339-72763361 GTTTATGTTTATCCTGCTCAAGG + Intronic
932564540 2:72897244-72897266 GTCTCTGTGTATGCACATCACGG + Intergenic
934276544 2:91576860-91576882 GTATATATATATACACCCCAAGG + Intergenic
934895112 2:98111318-98111340 GTTTATATATATAGACCACATGG - Intronic
934977544 2:98815337-98815359 TTTTATGCATGTGCAGCTCAGGG + Intronic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
937729560 2:125211842-125211864 GTTTTTCTATCTTCACCTCAAGG - Intergenic
940268212 2:151862516-151862538 GTTTTTGCAGATACACCTCAGGG + Intronic
941012088 2:160311523-160311545 GTGTATGTAAATGCTTCTCAGGG + Intronic
941130236 2:161639347-161639369 TTTTATGTATATGTTCATCAGGG - Intronic
941470767 2:165884042-165884064 ATTTATGTTTATGCATCTTATGG - Intronic
946173972 2:217911511-217911533 GTTTATGAAAAGGCATCTCAGGG - Intronic
1171521564 20:25779346-25779368 GATTTTCTATATGCACATCAAGG + Intronic
1171783277 20:29440602-29440624 GTTTGTATACATGCACATCAAGG - Intergenic
1174214787 20:48908068-48908090 GTTAATGTATATGCAGCACCTGG - Intergenic
1174769198 20:53282528-53282550 GTTCAGGTATAAGCCCCTCAAGG + Intronic
1174957893 20:55121255-55121277 GTTGATGTAGATGTACCTCTGGG - Intergenic
1177651677 21:23967064-23967086 CTTTAGGTGTAGGCACCTCAAGG + Intergenic
1182976543 22:34627679-34627701 GTTTAAATAAATGCACCTCTTGG + Intergenic
1183114436 22:35679342-35679364 TTTTATGTATATGAATGTCAAGG - Intergenic
1183400672 22:37602082-37602104 GCTTATGTAGATTCACCTCAAGG - Intergenic
1183684187 22:39351911-39351933 GTTTATACATATGCACATCCAGG + Intronic
950995304 3:17489856-17489878 GTTACTGTATATGTACCTGAAGG - Intronic
955843188 3:63133362-63133384 GTTGATGTCTATGCATCTCAAGG - Intergenic
956961943 3:74413390-74413412 GTATATGTATATGAAACACATGG - Intronic
957082202 3:75645960-75645982 GTTTGTATACATGCACATCAAGG + Intergenic
960741822 3:120842661-120842683 GTTTCTGTACATGTGCCTCAGGG + Intergenic
963539741 3:146569976-146569998 GTTTTTGTACATTCATCTCATGG + Intergenic
963577499 3:147079272-147079294 ATCTATGTATATGCAACCCAGGG - Intergenic
964064720 3:152563731-152563753 GTTCATGATTCTGCACCTCAAGG + Intergenic
965975873 3:174621533-174621555 GTCTATATATATAGACCTCAAGG - Intronic
966928806 3:184662614-184662636 GTTTCTCTATTTGCACCACAAGG + Intronic
967523778 3:190468480-190468502 GTTTAAGTAGATGAACCCCAAGG - Intergenic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
972737199 4:41854192-41854214 TTTTATGAAAATGGACCTCAAGG + Intergenic
977007136 4:91582011-91582033 GTTTATGTATATGCACCTCAAGG + Intronic
978887770 4:113785249-113785271 GATTATGTATGTGCAGCTCCTGG - Intergenic
979070339 4:116195706-116195728 GTTTATGCATATACACATAATGG + Intergenic
981488616 4:145315623-145315645 GTTGTTGTCTATGCACCTCATGG - Intergenic
991994764 5:72376152-72376174 GTCTATATATTTGCACCTCTGGG - Intergenic
994340817 5:98625651-98625673 ATTTGTGCATATGCACCTGAGGG + Intergenic
998573993 5:143292985-143293007 GTTTGTGTATATAAACCACAAGG - Intronic
1002974698 6:2062550-2062572 GTTTATGTATATATACATTATGG - Intronic
1003935941 6:10975443-10975465 GTTTAGGTATATCCAGTTCAGGG + Intronic
1010068956 6:71720614-71720636 ATTTGTGTATTTGCACCTAACGG + Intergenic
1011473402 6:87729999-87730021 TTTTATGTATATGAAACTCTGGG - Intergenic
1011931213 6:92716442-92716464 GTGTATGTATATGCACGACACGG - Intergenic
1014891102 6:126847327-126847349 GTTATTGTATCTGCAACTCATGG + Intergenic
1018597704 6:165500912-165500934 GTTTGTGTACGTGCACATCAAGG + Intronic
1018858370 6:167691924-167691946 AATTATGAATATGCACCCCACGG + Intergenic
1019935064 7:4249428-4249450 GTTCCTGCAAATGCACCTCATGG + Intronic
1021192615 7:17639177-17639199 ATTTATATATATGCAGCTCCTGG - Intergenic
1023634800 7:42198743-42198765 GTGTGTGCATATGCATCTCAAGG - Intronic
1024266501 7:47610873-47610895 GTTTATGGAGATGAATCTCATGG + Intergenic
1026442422 7:70456084-70456106 GGTTATATGTATGCACATCATGG + Intronic
1027862554 7:83603248-83603270 GTTTATTTACATGAACTTCAGGG - Intronic
1028158841 7:87463430-87463452 GTGTCTATATATGCACCTTAGGG + Intronic
1029272770 7:99386707-99386729 TTTCATAGATATGCACCTCATGG - Exonic
1030780112 7:113590371-113590393 GTTCATGTATTTTTACCTCAAGG + Intergenic
1033678546 7:143569177-143569199 GTTTATGTCTTTTAACCTCAAGG + Intergenic
1033693295 7:143760272-143760294 GTTTATGTCTTTTAACCTCAAGG - Intergenic
1037101788 8:15055795-15055817 GTGGATGAAAATGCACCTCAAGG - Intronic
1037426747 8:18763916-18763938 GATTATGTTTATAAACCTCATGG - Intronic
1043185727 8:77146512-77146534 CTTTAGGTTTATGCAGCTCAAGG + Intergenic
1044427756 8:92072980-92073002 GTTTATGTTCATGCATATCATGG - Intronic
1047170097 8:122484320-122484342 GTTTATGGATATACATGTCAAGG - Intergenic
1052214921 9:25954348-25954370 GGTTATGCATATGCACCCAAAGG + Intergenic
1052294076 9:26878335-26878357 GTTTATGTATATGGTCATTATGG + Intronic
1052334397 9:27304961-27304983 GCTTATGTATATGCACATGAGGG - Intergenic
1052601774 9:30642212-30642234 GTATATATATATGTACCTTATGG - Intergenic
1053352669 9:37423814-37423836 GTTTATGTATATGAAGCACCTGG - Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1057587942 9:96346408-96346430 GTTTATGCAGATGCATCTCAGGG + Intronic
1058560922 9:106228434-106228456 CTCTCTGTATATGCAACTCAGGG + Intergenic
1058589114 9:106542863-106542885 GTTTCTGTATATCCTCCTCAGGG + Intergenic
1188782785 X:34306080-34306102 GTAGATGTCTATGCCCCTCAAGG - Intergenic
1189124079 X:38426961-38426983 GTTTGTAAATATGCAACTCAGGG + Intronic
1189673627 X:43438683-43438705 GATTATGTATATGGGCCTGAGGG + Intergenic
1190424533 X:50321023-50321045 ATTTATGTATATTCACTACAGGG - Intronic
1194616078 X:96105068-96105090 GTTACTGTATACGTACCTCAGGG - Intergenic
1196131129 X:112157674-112157696 TTTTATGTTTATGCACAGCAGGG + Intergenic
1199391947 X:147290565-147290587 GTTTATGTACATGTTCTTCAGGG - Intergenic
1200833658 Y:7711970-7711992 GTTTGTGTGTGTGCACATCAAGG + Intergenic
1202069536 Y:20976394-20976416 GTTTGTATATGTGCACATCAAGG - Intergenic