ID: 977018480

View in Genome Browser
Species Human (GRCh38)
Location 4:91727012-91727034
Sequence ATGAATAAACAGAAAAATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977018480_977018481 20 Left 977018480 4:91727012-91727034 CCTCGATTTTTCTGTTTATTCAT No data
Right 977018481 4:91727055-91727077 TTCTTCTTCCACTTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977018480 Original CRISPR ATGAATAAACAGAAAAATCG AGG (reversed) Intergenic
No off target data available for this crispr