ID: 977019910

View in Genome Browser
Species Human (GRCh38)
Location 4:91746338-91746360
Sequence GAGGGAAGTTCTAGGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977019904_977019910 3 Left 977019904 4:91746312-91746334 CCGTCTCATTTGGGTAGGCTCTG No data
Right 977019910 4:91746338-91746360 GAGGGAAGTTCTAGGGGTGAAGG No data
977019900_977019910 23 Left 977019900 4:91746292-91746314 CCAGGGTTGGTTTTCTGGTTCCG No data
Right 977019910 4:91746338-91746360 GAGGGAAGTTCTAGGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977019910 Original CRISPR GAGGGAAGTTCTAGGGGTGA AGG Intergenic