ID: 977020631

View in Genome Browser
Species Human (GRCh38)
Location 4:91754852-91754874
Sequence GATCTACTTCCTGACTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977020631_977020639 29 Left 977020631 4:91754852-91754874 CCATGTGAGTCAGGAAGTAGATC No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data
977020631_977020638 18 Left 977020631 4:91754852-91754874 CCATGTGAGTCAGGAAGTAGATC No data
Right 977020638 4:91754893-91754915 CCTCTGGAAGACTGCAGCTTTGG No data
977020631_977020634 2 Left 977020631 4:91754852-91754874 CCATGTGAGTCAGGAAGTAGATC No data
Right 977020634 4:91754877-91754899 CCAGCCCTACATCAAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977020631 Original CRISPR GATCTACTTCCTGACTCACA TGG (reversed) Intergenic