ID: 977020632

View in Genome Browser
Species Human (GRCh38)
Location 4:91754874-91754896
Sequence GAGGTTTGATGTAGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977020632_977020639 7 Left 977020632 4:91754874-91754896 CCTCCAGCCCTACATCAAACCTC No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data
977020632_977020638 -4 Left 977020632 4:91754874-91754896 CCTCCAGCCCTACATCAAACCTC No data
Right 977020638 4:91754893-91754915 CCTCTGGAAGACTGCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977020632 Original CRISPR GAGGTTTGATGTAGGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr