ID: 977020633 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:91754877-91754899 |
Sequence | CCAGAGGTTTGATGTAGGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
977020633_977020638 | -7 | Left | 977020633 | 4:91754877-91754899 | CCAGCCCTACATCAAACCTCTGG | No data | ||
Right | 977020638 | 4:91754893-91754915 | CCTCTGGAAGACTGCAGCTTTGG | No data | ||||
977020633_977020639 | 4 | Left | 977020633 | 4:91754877-91754899 | CCAGCCCTACATCAAACCTCTGG | No data | ||
Right | 977020639 | 4:91754904-91754926 | CTGCAGCTTTGGCCAACAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
977020633 | Original CRISPR | CCAGAGGTTTGATGTAGGGC TGG (reversed) | Intergenic | ||