ID: 977020634

View in Genome Browser
Species Human (GRCh38)
Location 4:91754877-91754899
Sequence CCAGCCCTACATCAAACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977020631_977020634 2 Left 977020631 4:91754852-91754874 CCATGTGAGTCAGGAAGTAGATC No data
Right 977020634 4:91754877-91754899 CCAGCCCTACATCAAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977020634 Original CRISPR CCAGCCCTACATCAAACCTC TGG Intergenic