ID: 977020634 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:91754877-91754899 |
| Sequence | CCAGCCCTACATCAAACCTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977020631_977020634 | 2 | Left | 977020631 | 4:91754852-91754874 | CCATGTGAGTCAGGAAGTAGATC | No data | ||
| Right | 977020634 | 4:91754877-91754899 | CCAGCCCTACATCAAACCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977020634 | Original CRISPR | CCAGCCCTACATCAAACCTC TGG | Intergenic | ||