ID: 977020635

View in Genome Browser
Species Human (GRCh38)
Location 4:91754881-91754903
Sequence TCTTCCAGAGGTTTGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977020635_977020639 0 Left 977020635 4:91754881-91754903 CCCTACATCAAACCTCTGGAAGA No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977020635 Original CRISPR TCTTCCAGAGGTTTGATGTA GGG (reversed) Intergenic
No off target data available for this crispr