ID: 977020638

View in Genome Browser
Species Human (GRCh38)
Location 4:91754893-91754915
Sequence CCTCTGGAAGACTGCAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977020631_977020638 18 Left 977020631 4:91754852-91754874 CCATGTGAGTCAGGAAGTAGATC No data
Right 977020638 4:91754893-91754915 CCTCTGGAAGACTGCAGCTTTGG No data
977020632_977020638 -4 Left 977020632 4:91754874-91754896 CCTCCAGCCCTACATCAAACCTC No data
Right 977020638 4:91754893-91754915 CCTCTGGAAGACTGCAGCTTTGG No data
977020633_977020638 -7 Left 977020633 4:91754877-91754899 CCAGCCCTACATCAAACCTCTGG No data
Right 977020638 4:91754893-91754915 CCTCTGGAAGACTGCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977020638 Original CRISPR CCTCTGGAAGACTGCAGCTT TGG Intergenic