ID: 977020639

View in Genome Browser
Species Human (GRCh38)
Location 4:91754904-91754926
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977020635_977020639 0 Left 977020635 4:91754881-91754903 CCCTACATCAAACCTCTGGAAGA No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data
977020633_977020639 4 Left 977020633 4:91754877-91754899 CCAGCCCTACATCAAACCTCTGG No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data
977020636_977020639 -1 Left 977020636 4:91754882-91754904 CCTACATCAAACCTCTGGAAGAC No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data
977020632_977020639 7 Left 977020632 4:91754874-91754896 CCTCCAGCCCTACATCAAACCTC No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data
977020631_977020639 29 Left 977020631 4:91754852-91754874 CCATGTGAGTCAGGAAGTAGATC No data
Right 977020639 4:91754904-91754926 CTGCAGCTTTGGCCAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type