ID: 977021945

View in Genome Browser
Species Human (GRCh38)
Location 4:91770616-91770638
Sequence GTGGCTCTCCTGATTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977021945_977021952 22 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021952 4:91770661-91770683 GGAGGCTATCTCCATGCCACTGG No data
977021945_977021950 1 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021950 4:91770640-91770662 GATGCTAGCACTTGGAGGCATGG No data
977021945_977021947 -7 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021947 4:91770632-91770654 GAGCCACAGATGCTAGCACTTGG No data
977021945_977021949 -4 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021949 4:91770635-91770657 CCACAGATGCTAGCACTTGGAGG No data
977021945_977021954 29 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021954 4:91770668-91770690 ATCTCCATGCCACTGGGTTCAGG No data
977021945_977021953 23 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021953 4:91770662-91770684 GAGGCTATCTCCATGCCACTGGG No data
977021945_977021951 4 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021951 4:91770643-91770665 GCTAGCACTTGGAGGCATGGAGG No data
977021945_977021955 30 Left 977021945 4:91770616-91770638 CCCACATCAATCAGGAGAGCCAC No data
Right 977021955 4:91770669-91770691 TCTCCATGCCACTGGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977021945 Original CRISPR GTGGCTCTCCTGATTGATGT GGG (reversed) Intergenic
No off target data available for this crispr