ID: 977031619

View in Genome Browser
Species Human (GRCh38)
Location 4:91891377-91891399
Sequence AGTTATCTACAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977031619_977031623 15 Left 977031619 4:91891377-91891399 CCTGCCATCTTCTGTAGATAACT No data
Right 977031623 4:91891415-91891437 GACAGCTCTTTTTCTGTTACTGG No data
977031619_977031625 22 Left 977031619 4:91891377-91891399 CCTGCCATCTTCTGTAGATAACT No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data
977031619_977031626 25 Left 977031619 4:91891377-91891399 CCTGCCATCTTCTGTAGATAACT No data
Right 977031626 4:91891425-91891447 TTTCTGTTACTGGGCTTTGGTGG No data
977031619_977031624 16 Left 977031619 4:91891377-91891399 CCTGCCATCTTCTGTAGATAACT No data
Right 977031624 4:91891416-91891438 ACAGCTCTTTTTCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977031619 Original CRISPR AGTTATCTACAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr