ID: 977031620

View in Genome Browser
Species Human (GRCh38)
Location 4:91891381-91891403
Sequence GAATAGTTATCTACAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977031620_977031626 21 Left 977031620 4:91891381-91891403 CCATCTTCTGTAGATAACTATTC No data
Right 977031626 4:91891425-91891447 TTTCTGTTACTGGGCTTTGGTGG No data
977031620_977031625 18 Left 977031620 4:91891381-91891403 CCATCTTCTGTAGATAACTATTC No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data
977031620_977031624 12 Left 977031620 4:91891381-91891403 CCATCTTCTGTAGATAACTATTC No data
Right 977031624 4:91891416-91891438 ACAGCTCTTTTTCTGTTACTGGG No data
977031620_977031623 11 Left 977031620 4:91891381-91891403 CCATCTTCTGTAGATAACTATTC No data
Right 977031623 4:91891415-91891437 GACAGCTCTTTTTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977031620 Original CRISPR GAATAGTTATCTACAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr