ID: 977031622

View in Genome Browser
Species Human (GRCh38)
Location 4:91891406-91891428
Sequence GAAAAAGAGCTGTCTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977031622_977031626 -4 Left 977031622 4:91891406-91891428 CCTTTGAGAGACAGCTCTTTTTC No data
Right 977031626 4:91891425-91891447 TTTCTGTTACTGGGCTTTGGTGG No data
977031622_977031625 -7 Left 977031622 4:91891406-91891428 CCTTTGAGAGACAGCTCTTTTTC No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977031622 Original CRISPR GAAAAAGAGCTGTCTCTCAA AGG (reversed) Intergenic
No off target data available for this crispr