ID: 977031625

View in Genome Browser
Species Human (GRCh38)
Location 4:91891422-91891444
Sequence CTTTTTCTGTTACTGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977031619_977031625 22 Left 977031619 4:91891377-91891399 CCTGCCATCTTCTGTAGATAACT No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data
977031622_977031625 -7 Left 977031622 4:91891406-91891428 CCTTTGAGAGACAGCTCTTTTTC No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data
977031620_977031625 18 Left 977031620 4:91891381-91891403 CCATCTTCTGTAGATAACTATTC No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data
977031621_977031625 -6 Left 977031621 4:91891405-91891427 CCCTTTGAGAGACAGCTCTTTTT No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data
977031618_977031625 23 Left 977031618 4:91891376-91891398 CCCTGCCATCTTCTGTAGATAAC No data
Right 977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977031625 Original CRISPR CTTTTTCTGTTACTGGGCTT TGG Intergenic
No off target data available for this crispr