ID: 977033362

View in Genome Browser
Species Human (GRCh38)
Location 4:91916777-91916799
Sequence CAATGAATGAAACACAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977033361_977033362 -7 Left 977033361 4:91916761-91916783 CCGTTTCTATTCAGTGCAATGAA No data
Right 977033362 4:91916777-91916799 CAATGAATGAAACACAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977033362 Original CRISPR CAATGAATGAAACACAGACA TGG Intergenic
No off target data available for this crispr