ID: 977033890

View in Genome Browser
Species Human (GRCh38)
Location 4:91924871-91924893
Sequence GCCCACACTGCTGGCACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977033890_977033899 14 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033899 4:91924908-91924930 TAGGAGGTAGGCAGGCTTCTGGG No data
977033890_977033897 6 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033897 4:91924900-91924922 AACGGCTGTAGGAGGTAGGCAGG No data
977033890_977033900 17 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033900 4:91924911-91924933 GAGGTAGGCAGGCTTCTGGGTGG No data
977033890_977033896 2 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033896 4:91924896-91924918 GATGAACGGCTGTAGGAGGTAGG No data
977033890_977033902 24 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033902 4:91924918-91924940 GCAGGCTTCTGGGTGGAAGTGGG No data
977033890_977033898 13 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033898 4:91924907-91924929 GTAGGAGGTAGGCAGGCTTCTGG No data
977033890_977033894 -5 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033894 4:91924889-91924911 TGGGCATGATGAACGGCTGTAGG No data
977033890_977033901 23 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033901 4:91924917-91924939 GGCAGGCTTCTGGGTGGAAGTGG No data
977033890_977033895 -2 Left 977033890 4:91924871-91924893 CCCTTGGTGCCAGCAGTGTGGGC No data
Right 977033895 4:91924892-91924914 GCATGATGAACGGCTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977033890 Original CRISPR GCCCACACTGCTGGCACCAA GGG (reversed) Intergenic
No off target data available for this crispr