ID: 977036583

View in Genome Browser
Species Human (GRCh38)
Location 4:91960760-91960782
Sequence AGTTATCTTTTGAAGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977036583_977036584 15 Left 977036583 4:91960760-91960782 CCTCTCATCTTCAAAAGATAACT No data
Right 977036584 4:91960798-91960820 AATAGTTCTTGACCAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977036583 Original CRISPR AGTTATCTTTTGAAGATGAG AGG (reversed) Intergenic
No off target data available for this crispr