ID: 977036584

View in Genome Browser
Species Human (GRCh38)
Location 4:91960798-91960820
Sequence AATAGTTCTTGACCAGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977036582_977036584 16 Left 977036582 4:91960759-91960781 CCCTCTCATCTTCAAAAGATAAC No data
Right 977036584 4:91960798-91960820 AATAGTTCTTGACCAGCTGTTGG No data
977036583_977036584 15 Left 977036583 4:91960760-91960782 CCTCTCATCTTCAAAAGATAACT No data
Right 977036584 4:91960798-91960820 AATAGTTCTTGACCAGCTGTTGG No data
977036581_977036584 17 Left 977036581 4:91960758-91960780 CCCCTCTCATCTTCAAAAGATAA No data
Right 977036584 4:91960798-91960820 AATAGTTCTTGACCAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977036584 Original CRISPR AATAGTTCTTGACCAGCTGT TGG Intergenic
No off target data available for this crispr