ID: 977041091

View in Genome Browser
Species Human (GRCh38)
Location 4:92020035-92020057
Sequence CTGTTCTTAAATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977041091_977041094 -8 Left 977041091 4:92020035-92020057 CCTTCTTCCCTATTTAAGAACAG No data
Right 977041094 4:92020050-92020072 AAGAACAGTAAACTTTATATAGG No data
977041091_977041095 12 Left 977041091 4:92020035-92020057 CCTTCTTCCCTATTTAAGAACAG No data
Right 977041095 4:92020070-92020092 AGGTACCATCTGTATAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977041091 Original CRISPR CTGTTCTTAAATAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr