ID: 977041094

View in Genome Browser
Species Human (GRCh38)
Location 4:92020050-92020072
Sequence AAGAACAGTAAACTTTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977041091_977041094 -8 Left 977041091 4:92020035-92020057 CCTTCTTCCCTATTTAAGAACAG No data
Right 977041094 4:92020050-92020072 AAGAACAGTAAACTTTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977041094 Original CRISPR AAGAACAGTAAACTTTATAT AGG Intergenic
No off target data available for this crispr