ID: 977041095

View in Genome Browser
Species Human (GRCh38)
Location 4:92020070-92020092
Sequence AGGTACCATCTGTATAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977041092_977041095 5 Left 977041092 4:92020042-92020064 CCCTATTTAAGAACAGTAAACTT No data
Right 977041095 4:92020070-92020092 AGGTACCATCTGTATAATCCAGG No data
977041091_977041095 12 Left 977041091 4:92020035-92020057 CCTTCTTCCCTATTTAAGAACAG No data
Right 977041095 4:92020070-92020092 AGGTACCATCTGTATAATCCAGG No data
977041093_977041095 4 Left 977041093 4:92020043-92020065 CCTATTTAAGAACAGTAAACTTT No data
Right 977041095 4:92020070-92020092 AGGTACCATCTGTATAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977041095 Original CRISPR AGGTACCATCTGTATAATCC AGG Intergenic
No off target data available for this crispr