ID: 977048809

View in Genome Browser
Species Human (GRCh38)
Location 4:92100929-92100951
Sequence CCTTCTGTACTGGAAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977048809_977048812 4 Left 977048809 4:92100929-92100951 CCTTTTTCTTCCAGTACAGAAGG No data
Right 977048812 4:92100956-92100978 CTCTATCTTAGTACACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977048809 Original CRISPR CCTTCTGTACTGGAAGAAAA AGG (reversed) Intergenic
No off target data available for this crispr