ID: 977056914

View in Genome Browser
Species Human (GRCh38)
Location 4:92204126-92204148
Sequence GAAACTATAAAGCAACTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977056913_977056914 -4 Left 977056913 4:92204107-92204129 CCATTTGAATTCTTTTAAAGAAA No data
Right 977056914 4:92204126-92204148 GAAACTATAAAGCAACTTAAAGG No data
977056912_977056914 20 Left 977056912 4:92204083-92204105 CCATTTTTTAATTCATTCTAAGA No data
Right 977056914 4:92204126-92204148 GAAACTATAAAGCAACTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977056914 Original CRISPR GAAACTATAAAGCAACTTAA AGG Intergenic
No off target data available for this crispr