ID: 977058535

View in Genome Browser
Species Human (GRCh38)
Location 4:92225183-92225205
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977058525_977058535 9 Left 977058525 4:92225151-92225173 CCTAAGTTACTCTCTTCACTCCC No data
Right 977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr