ID: 977060696

View in Genome Browser
Species Human (GRCh38)
Location 4:92254487-92254509
Sequence GACGGGTGAGATACCCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060696_977060704 -5 Left 977060696 4:92254487-92254509 CCTGTTGGGGTATCTCACCCGTC No data
Right 977060704 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
977060696_977060705 18 Left 977060696 4:92254487-92254509 CCTGTTGGGGTATCTCACCCGTC No data
Right 977060705 4:92254528-92254550 ACCCACTTAACAAAGCACTCTGG No data
977060696_977060702 -6 Left 977060696 4:92254487-92254509 CCTGTTGGGGTATCTCACCCGTC No data
Right 977060702 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060696 Original CRISPR GACGGGTGAGATACCCCAAC AGG (reversed) Intergenic