ID: 977060701

View in Genome Browser
Species Human (GRCh38)
Location 4:92254504-92254526
Sequence CCAGATCCTGTGCCCCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060701_977060712 21 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG No data
977060701_977060705 1 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060705 4:92254528-92254550 ACCCACTTAACAAAGCACTCTGG No data
977060701_977060711 20 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060701_977060710 19 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060710 4:92254546-92254568 TCTGGCTGTCCCTTTGTGGAGGG No data
977060701_977060708 15 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060708 4:92254542-92254564 GCACTCTGGCTGTCCCTTTGTGG No data
977060701_977060709 18 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060701 Original CRISPR CCAGATCCTGTGCCCCTGAC GGG (reversed) Intergenic
No off target data available for this crispr