ID: 977060703

View in Genome Browser
Species Human (GRCh38)
Location 4:92254505-92254527
Sequence CCCAGATCCTGTGCCCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060703_977060709 17 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data
977060703_977060710 18 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060710 4:92254546-92254568 TCTGGCTGTCCCTTTGTGGAGGG No data
977060703_977060705 0 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060705 4:92254528-92254550 ACCCACTTAACAAAGCACTCTGG No data
977060703_977060711 19 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060703_977060708 14 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060708 4:92254542-92254564 GCACTCTGGCTGTCCCTTTGTGG No data
977060703_977060712 20 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060703 Original CRISPR CCCAGATCCTGTGCCCCTGA CGG (reversed) Intergenic