ID: 977060705

View in Genome Browser
Species Human (GRCh38)
Location 4:92254528-92254550
Sequence ACCCACTTAACAAAGCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060696_977060705 18 Left 977060696 4:92254487-92254509 CCTGTTGGGGTATCTCACCCGTC No data
Right 977060705 4:92254528-92254550 ACCCACTTAACAAAGCACTCTGG No data
977060703_977060705 0 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060705 4:92254528-92254550 ACCCACTTAACAAAGCACTCTGG No data
977060701_977060705 1 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060705 4:92254528-92254550 ACCCACTTAACAAAGCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060705 Original CRISPR ACCCACTTAACAAAGCACTC TGG Intergenic