ID: 977060706

View in Genome Browser
Species Human (GRCh38)
Location 4:92254529-92254551
Sequence GCCAGAGTGCTTTGTTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060706_977060719 24 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060719 4:92254576-92254598 TGCACTTGGGGGAAACCCACTGG No data
977060706_977060711 -5 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060706_977060708 -10 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060708 4:92254542-92254564 GCACTCTGGCTGTCCCTTTGTGG No data
977060706_977060718 13 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060718 4:92254565-92254587 AGGGGGTGTTCTGCACTTGGGGG No data
977060706_977060721 30 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060721 4:92254582-92254604 TGGGGGAAACCCACTGGTCTGGG No data
977060706_977060709 -7 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data
977060706_977060715 10 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060715 4:92254562-92254584 TGGAGGGGGTGTTCTGCACTTGG No data
977060706_977060720 29 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060720 4:92254581-92254603 TTGGGGGAAACCCACTGGTCTGG No data
977060706_977060716 11 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060716 4:92254563-92254585 GGAGGGGGTGTTCTGCACTTGGG No data
977060706_977060717 12 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060717 4:92254564-92254586 GAGGGGGTGTTCTGCACTTGGGG No data
977060706_977060712 -4 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG No data
977060706_977060710 -6 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060710 4:92254546-92254568 TCTGGCTGTCCCTTTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060706 Original CRISPR GCCAGAGTGCTTTGTTAAGT GGG (reversed) Intergenic
No off target data available for this crispr