ID: 977060707

View in Genome Browser
Species Human (GRCh38)
Location 4:92254530-92254552
Sequence AGCCAGAGTGCTTTGTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 17, 1: 21, 2: 42, 3: 158, 4: 432}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060707_977060717 11 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060717 4:92254564-92254586 GAGGGGGTGTTCTGCACTTGGGG No data
977060707_977060719 23 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060719 4:92254576-92254598 TGCACTTGGGGGAAACCCACTGG No data
977060707_977060712 -5 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG No data
977060707_977060711 -6 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060707_977060721 29 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060721 4:92254582-92254604 TGGGGGAAACCCACTGGTCTGGG No data
977060707_977060715 9 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060715 4:92254562-92254584 TGGAGGGGGTGTTCTGCACTTGG No data
977060707_977060709 -8 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data
977060707_977060716 10 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060716 4:92254563-92254585 GGAGGGGGTGTTCTGCACTTGGG No data
977060707_977060720 28 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060720 4:92254581-92254603 TTGGGGGAAACCCACTGGTCTGG No data
977060707_977060710 -7 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060710 4:92254546-92254568 TCTGGCTGTCCCTTTGTGGAGGG No data
977060707_977060718 12 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060718 4:92254565-92254587 AGGGGGTGTTCTGCACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060707 Original CRISPR AGCCAGAGTGCTTTGTTAAG TGG (reversed) Intergenic
900529492 1:3145710-3145732 AGCCAGAGCGCTTTCTACAGGGG - Intronic
900935715 1:5765166-5765188 AGCGAGAGTGCTCTGTAGAGAGG + Intergenic
901000509 1:6146710-6146732 AGAGAGAGTTCTTTGTCAAGTGG - Exonic
902519483 1:17007933-17007955 AGCCAGAGTGCTTGGGGATGGGG - Intronic
902868241 1:19295370-19295392 AGCCAGAGTGTTTTGGCAAAGGG + Intergenic
905952664 1:41964909-41964931 AGCCAGAGTGCTTCATTATGTGG + Intronic
906954360 1:50359715-50359737 AGCCAAAGTGCTTTGTTAAATGG + Intergenic
907713357 1:56904984-56905006 AGCCAGAGTGATTACTTAGGTGG - Intronic
908910858 1:69071462-69071484 AGCCAAAGTGCTTTGTTAAATGG - Intergenic
909597456 1:77422466-77422488 AGTCAGTGTGTTTTGATAAGTGG - Intronic
909677875 1:78257793-78257815 AGCCAGACTGCTTTGTTAAGAGG + Intergenic
909697591 1:78484499-78484521 AGTCAAAGTGCTTTGTTAAATGG + Intronic
909926375 1:81442203-81442225 AGCCAGACTTCTTTTTTAAAAGG - Intronic
909992394 1:82239593-82239615 AGCCAGACTGCTTATTTAAGTGG - Intergenic
910619295 1:89235755-89235777 AGCCAATGTGCTTTGGTAAGTGG - Intergenic
911242830 1:95483797-95483819 ATCCAAAGTGCTTTGTTAAATGG + Intergenic
912221084 1:107676246-107676268 AGCCAGAGTGCTCTGTTGATTGG - Intronic
913077738 1:115355264-115355286 AGCCAGACTGCTGTGCTAATTGG + Intergenic
913397425 1:118387699-118387721 GGCCAGTGTGCTATGTTGAGGGG - Intergenic
913541107 1:119822121-119822143 GGACAAAGTGCTTTGTTAAAGGG - Intergenic
914404668 1:147358613-147358635 AGCCAAAGTGCTTTGTTAAATGG + Intergenic
914439429 1:147690925-147690947 ATCCAGAGTGCTGAGTTATGGGG - Intergenic
915659226 1:157388603-157388625 AGCCAGACTGCTTATTTAAGTGG - Intergenic
915844784 1:159252182-159252204 GGCCAGACTGCTTTTTTAAGTGG + Intergenic
915990676 1:160512506-160512528 AGACAGAATGCTTCATTAAGTGG + Intronic
916174967 1:162030571-162030593 AGCCAGAGTCCTGTGCTGAGTGG + Intergenic
916848960 1:168683713-168683735 AGCCAAAGTGCTTCCTTAAATGG - Intergenic
917059197 1:171018044-171018066 AGCCAAAGTGCTTTGTTAAGTGG + Intronic
917060502 1:171032774-171032796 GGACAAAGTGCTTTGTTAAATGG - Intronic
917259202 1:173148694-173148716 GGTCAGACTGCTTTTTTAAGTGG - Intergenic
917352206 1:174089996-174090018 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
917418616 1:174838317-174838339 ACCCAGAGTCCTTTCCTAAGGGG + Intronic
918527271 1:185478730-185478752 AAGCAGAGTGCTTTCTTCAGGGG + Intergenic
918690890 1:187478067-187478089 AGCAAGAATGATTTTTTAAGGGG - Intergenic
918839295 1:189513519-189513541 AGCCAGAGTGTGTTGCTAAGTGG + Intergenic
921013091 1:211161956-211161978 TGCCAGACTGCTTTTTAAAGTGG - Intergenic
922384887 1:225072992-225073014 GGCCAGACTACTTTGTTAAGTGG - Intronic
922384982 1:225073458-225073480 GGCCAGACTGCTTCTTTAAGTGG - Intronic
922399613 1:225238874-225238896 GGCCAGACTGCTTCTTTAAGAGG - Intronic
922693635 1:227714048-227714070 AGCCAAAGTGCTATGTTAAATGG + Intergenic
923195508 1:231662503-231662525 GGCCAGATTGCTTCGTTAAGTGG - Intronic
924629613 1:245724357-245724379 AGCCAGACTGCTTCTTTAAATGG + Intergenic
1063211566 10:3885756-3885778 AGGGAGAGTGCTTTGCTAGGTGG - Intergenic
1063297457 10:4821380-4821402 AGGCTGAGTGCTTTGTTGTGAGG + Intronic
1064370419 10:14747794-14747816 AGCCAGAGTGCTTCATTAATTGG - Intronic
1065196477 10:23270825-23270847 GGCCAGACTGCTTCTTTAAGTGG + Intronic
1067562566 10:47314258-47314280 AGCCATAGTGGTTTTCTAAGAGG + Intergenic
1067923267 10:50481183-50481205 AGCCAGAGTGCTTCATTAAGAGG + Intronic
1068186560 10:53593490-53593512 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
1068381107 10:56254935-56254957 AGCCAGACTGCTTATTTAAGTGG - Intergenic
1069216119 10:65823498-65823520 AGCCTGGGTGCTGTGTTAAAAGG + Intergenic
1069281750 10:66663157-66663179 AGCCAGAATGATCTGTTAAAAGG + Intronic
1069370994 10:67747278-67747300 AGCCAGCGTGCTTTATTAAGTGG + Intergenic
1069759398 10:70798237-70798259 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
1070054743 10:72923991-72924013 AGCCAGACTGCTTCTTTAAGTGG - Intronic
1074022048 10:109594223-109594245 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
1075230476 10:120671878-120671900 AGCCAGAGTGCTCCATTAAGTGG + Intergenic
1075977159 10:126706039-126706061 AGCCAGAGTGCTGTCTCAAGAGG + Intergenic
1077855124 11:6116249-6116271 AGCCAGAGTGCTTTGTAAAGTGG + Intergenic
1078033658 11:7780500-7780522 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
1078576005 11:12503351-12503373 ATCCAGAGTTCATGGTTAAGTGG + Intronic
1078815976 11:14822983-14823005 AGCCAGCTTGCTTTTTTATGTGG + Intronic
1079080067 11:17407764-17407786 GGCCACAGTGATTTGTTCAGGGG + Intronic
1079437661 11:20474177-20474199 AGCCAGACTCCTTCTTTAAGCGG - Intronic
1079580352 11:22055898-22055920 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1079587994 11:22149836-22149858 AGCGAGGATGCTTGGTTAAGCGG - Intergenic
1079654691 11:22973730-22973752 AGCCAGGCTGCTTCTTTAAGTGG - Intergenic
1080214702 11:29827460-29827482 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1080214753 11:29827720-29827742 AGCCAGACTGCTTATTTAAGTGG + Intergenic
1080292576 11:30687851-30687873 GGCCAGACTGCTTCTTTAAGCGG + Intergenic
1080513724 11:33000941-33000963 AGCTAGACTGCTTCTTTAAGAGG - Intergenic
1080513779 11:33001197-33001219 GGCCAGAATGCTTCTTTAAGTGG - Intergenic
1080649765 11:34212763-34212785 AGCCAGAATGAAGTGTTAAGTGG - Intronic
1080731364 11:34958278-34958300 ATCCACAGTGCTTTTTTTAGGGG + Intronic
1081005999 11:37740708-37740730 AGGCAGAGTACTTTTTTAAAAGG - Intergenic
1081930927 11:46870678-46870700 AGCCAGAGTGCTGTGATTACAGG + Intronic
1082746475 11:56968498-56968520 AGTCAGACTGCTTCTTTAAGTGG - Intergenic
1082757498 11:57092327-57092349 GGCCAAACTGCTTTCTTAAGTGG - Intergenic
1082924137 11:58528043-58528065 ACCCAGAGTGCTTTGTTTGTGGG - Exonic
1083008126 11:59368006-59368028 GGCCAGACTGCTTTTTCAAGTGG + Intergenic
1085335112 11:75687612-75687634 AGCCAGACTGCTTCCTTAAGCGG - Intergenic
1086279803 11:85172105-85172127 AGCCATACTGCTTGTTTAAGTGG + Intronic
1087374786 11:97326946-97326968 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1087606531 11:100384384-100384406 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1087881327 11:103419284-103419306 AGCCAGACTGATTCTTTAAGTGG + Intronic
1088004900 11:104927703-104927725 AGTCAAAGTGCTTTGTTAAATGG + Intergenic
1088020463 11:105112118-105112140 AGCCAGACTACTTCCTTAAGTGG + Intergenic
1088037468 11:105334621-105334643 AGCCAGAATTCTTCTTTAAGTGG + Intergenic
1088828511 11:113515753-113515775 TGCCAGAGTGCTATGCTATGGGG + Intergenic
1090321162 11:125844860-125844882 GGCCAGGCTGCTTTTTTAAGTGG + Intergenic
1090740861 11:129658685-129658707 AGTCAGACTGCTTCCTTAAGTGG + Intergenic
1091698556 12:2644332-2644354 GGCCAGAGAGCATTGTGAAGGGG - Intronic
1092398119 12:8146403-8146425 GGCCAGACTGCTTCGTTAAGCGG + Intronic
1092398167 12:8146663-8146685 AGCCAGACTGCTTATTTAAGTGG + Intronic
1092639846 12:10493881-10493903 TGTCAGAGTGCTTCGTTAAATGG + Intergenic
1093075273 12:14751622-14751644 AGGAAGAGTACTTTTTTAAGAGG - Intergenic
1093303361 12:17479754-17479776 AGCCAAAGTGCTTCGTTAAATGG + Intergenic
1093340411 12:17967084-17967106 AGTCAGAGTGCTTCATTAAGGGG - Intergenic
1093522558 12:20067395-20067417 GGACAAAGTGCTTTGTTAAATGG + Intergenic
1094432005 12:30380019-30380041 AGCCAGAGTGCTTTGTTAAGTGG - Intergenic
1094694924 12:32809018-32809040 AGCCAGACTGCTTCTTTAAGCGG - Intronic
1095303418 12:40613770-40613792 AGCCAGATTGCTTCTTTAAGTGG - Intergenic
1095303462 12:40614035-40614057 GGCCAGACTCCTTTTTTAAGGGG - Intergenic
1095824382 12:46516320-46516342 GGCCAGACTGCTTTTTTAAGTGG - Intergenic
1096613939 12:52821128-52821150 AGACAGCATGCTTTGTTCAGTGG - Intergenic
1097498472 12:60373449-60373471 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1097521195 12:60672791-60672813 AGCCAGATGGCTTCTTTAAGCGG - Intergenic
1097529471 12:60780663-60780685 AGCCAAAGTGCTTTATTGAATGG - Intergenic
1097643065 12:62205324-62205346 AGCCAGAGTGCTTTATTAAGTGG - Intronic
1097890588 12:64773486-64773508 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1098047085 12:66411147-66411169 AGCCAGACTGCTTTTTTAAGCGG + Intronic
1098201779 12:68063980-68064002 AGCCAGAGTGCTTCATTAAATGG - Intergenic
1098214673 12:68203014-68203036 AGGCAGAGTGATTTTTTAAAAGG - Intronic
1098489453 12:71058657-71058679 AGCCAGACTGCTTTATAAAGTGG - Intronic
1098658763 12:73067562-73067584 GGCCAGACTGCTTGTTTAAGTGG - Intergenic
1099369419 12:81811780-81811802 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1100099975 12:91091677-91091699 AACCAGAGTGCTTCTTTAACTGG - Intergenic
1100115154 12:91294863-91294885 AGCCAGACTACTTATTTAAGTGG + Intergenic
1100740104 12:97582038-97582060 GGACAGACTGCTTTGTCAAGTGG + Intergenic
1101186848 12:102289513-102289535 AGCCAGAGTGCTTTATTAAGTGG - Intergenic
1102814043 12:115848342-115848364 AGGCAGAGTGTTTAGATAAGTGG + Intergenic
1104256339 12:127142840-127142862 GGACAAAGTGCTTTGTTAAATGG - Intergenic
1104549926 12:129747040-129747062 AGCCAGAGTGAATCGTTAAGAGG + Intronic
1105668404 13:22586338-22586360 AGCCAAAGTGCTTAGTTAAATGG - Intergenic
1107119293 13:36779333-36779355 AGCCAGATTGCTTCCCTAAGTGG + Intergenic
1107240791 13:38231524-38231546 AGCCAGACTACTTCTTTAAGAGG + Intergenic
1107314799 13:39119695-39119717 AGCCAGACTGCTTCTTTAGGTGG - Intergenic
1108144725 13:47464229-47464251 GGACAAAGTGCTTTGTTAAATGG + Intergenic
1108479756 13:50856568-50856590 AGCCAGACTACTTCTTTAAGTGG + Intergenic
1109072452 13:57787077-57787099 AGCCAGACTGCTTCATTATGTGG - Intergenic
1109146880 13:58790546-58790568 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1109483424 13:62986654-62986676 AGCCAGGCTGCATTGTTATGTGG - Intergenic
1109706002 13:66093548-66093570 AGCCAGTGAGCTTTGTATAGTGG - Intergenic
1109968812 13:69737887-69737909 AGTCAGACTGCTTATTTAAGTGG + Intronic
1110821785 13:79925717-79925739 AGTCAGAGTGCTTCATTAAGTGG - Intergenic
1110836875 13:80093591-80093613 AGCCAAAGTGCCTTGTTAAATGG - Intergenic
1111235249 13:85400662-85400684 GGCCAGACTGCTTTTTTAAATGG - Intergenic
1111348437 13:86994607-86994629 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
1111535892 13:89602817-89602839 ATTCAGAGTGCTTTTTCAAGTGG + Intergenic
1111615656 13:90658949-90658971 GGCCAGACTGCTTCCTTAAGTGG + Intergenic
1112179740 13:97066823-97066845 AACCAGAATTTTTTGTTAAGTGG + Intergenic
1113045021 13:106146377-106146399 AACCTGAGTGGTATGTTAAGTGG - Intergenic
1113124646 13:106963307-106963329 GACCAGAGTGCTCTGTAAAGAGG + Intergenic
1114295430 14:21324978-21325000 AGCAAGAGTGCTGTGTTCACTGG - Exonic
1114647669 14:24264501-24264523 AGCCAGAGGGCTTTGTGCAGGGG + Intergenic
1114958183 14:27849335-27849357 GGCCAGACTGCTTTTTTAGGTGG + Intergenic
1114958234 14:27849596-27849618 AGCCAGAGTGCTTTGTTAAGTGG + Intergenic
1114988648 14:28261882-28261904 GGTCAGAATGCTTTTTTAAGCGG + Intergenic
1114992043 14:28299247-28299269 GGCCAGAGTGCTGTTTTAAGTGG - Intergenic
1115924269 14:38413091-38413113 AGCCAAAGTGCCTTGTTAAATGG + Intergenic
1115927268 14:38449326-38449348 AGCCAGAGTGCTTCATCAATTGG + Intergenic
1115928773 14:38467477-38467499 AGTCAAAGTGCTTTATTAAATGG - Intergenic
1116312268 14:43342126-43342148 AGTCAGACTGCTTCCTTAAGCGG - Intergenic
1116317674 14:43417995-43418017 AGCGAGACTGCTTCTTTAAGTGG - Intergenic
1116396040 14:44449700-44449722 AGCCAGAGTGGTGGGGTAAGTGG + Intergenic
1117518558 14:56527455-56527477 AGCCTTACTGCTTTGCTAAGTGG - Intronic
1117660101 14:57995225-57995247 ACCCACAGGGCTTTGTTAATTGG + Intergenic
1117829243 14:59733641-59733663 GGCCAGACTGCTTCTTTAAGTGG + Intronic
1118523704 14:66617019-66617041 AGTCAAAGTGCTTCGTTAAATGG - Intronic
1118527369 14:66661405-66661427 GGCCAGACTGCTTCTTTAAGAGG + Intronic
1119940324 14:78633879-78633901 AGACAGAGTGGCTTGTTAAAAGG - Intronic
1120283137 14:82464132-82464154 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
1120368949 14:83607635-83607657 AGCCAGAGTGCTTTGCTAAGTGG - Intergenic
1120732252 14:88016931-88016953 AGCCACAGTGATTGGTTCAGTGG + Intergenic
1120799172 14:88669739-88669761 AGTCAGAGTGCTTCATTAAGTGG + Intronic
1120857926 14:89228957-89228979 AGCCAGCATGCTTTGGAAAGAGG - Intronic
1121364012 14:93290171-93290193 AGCTAGAGTGGTTTGGCAAGTGG - Intronic
1121706852 14:96002608-96002630 AGCCAAAGTGCTTCATTAAATGG + Intergenic
1124669235 15:31623218-31623240 AGACAGACTGCTTTCTCAAGTGG - Intronic
1124923549 15:34048702-34048724 AGCCAGACTGCTTCTTTAAGTGG + Intronic
1126029655 15:44483688-44483710 AAATAGAGAGCTTTGTTAAGGGG + Intronic
1126552941 15:49953209-49953231 AGACAAAGTGCTTCGTTAAATGG - Intronic
1126784254 15:52163728-52163750 AGCCAGACTGCTTCTTTAAGCGG + Intronic
1127042408 15:54991222-54991244 AGCCAAAGTGCCTTATTAAACGG + Intergenic
1128856755 15:71024254-71024276 AGCCAGAGTGCTTCATTAAGCGG + Intronic
1130185516 15:81677600-81677622 GGCCAGAGTGCTTCTTTAAGTGG + Intergenic
1130226763 15:82064983-82065005 AGTCACAGTGATTTGTTTAGAGG + Intergenic
1131264549 15:90907930-90907952 AGCAAGAGTGCTATCTTTAGGGG - Intronic
1131604237 15:93883984-93884006 CTCCAGAGTGCTTTGCTAACTGG + Intergenic
1134187672 16:12097375-12097397 AGCCAGAGGGCATTTTGAAGGGG + Intronic
1134454540 16:14384993-14385015 AGCCTCAGTTCTTAGTTAAGAGG - Intergenic
1136575988 16:31125684-31125706 AGGCACAGTGCTTTGTGGAGGGG + Intronic
1136643465 16:31588522-31588544 AGCCAGAATGCTTCGTTAAGTGG - Intergenic
1136662153 16:31772270-31772292 AGCCAGAATGCTTCATTAAGTGG + Intronic
1137758358 16:50920271-50920293 AGGCAGAGGGCTGTGTGAAGAGG + Intergenic
1140485021 16:75286963-75286985 TGCCAAAGTGCTCTGTAAAGTGG + Intergenic
1140670036 16:77269225-77269247 AGCAAGACTGCTTCTTTAAGTGG - Intronic
1142653871 17:1376894-1376916 ACCCTGTGTGCTTTGGTAAGAGG - Intronic
1143592776 17:7895475-7895497 AGCGAGAGTTCTTTGTCAAGTGG + Exonic
1147461052 17:40569191-40569213 GGCCAGACTGCTTCTTTAAGAGG + Intergenic
1148964382 17:51422440-51422462 AGCCACAGTGATTGGTTCAGGGG + Intergenic
1150039895 17:61849231-61849253 AGCCAGAGTGGTTTTTTCAGGGG + Exonic
1150629791 17:66871315-66871337 ACTCAGAGTGCTTTGATAAAAGG - Intronic
1151105737 17:71614718-71614740 AACCAGAGGGCTTTGCTGAGTGG - Intergenic
1152134421 17:78495389-78495411 AGACAGAGTGCTTTCTAAGGAGG + Intronic
1153596612 18:6731881-6731903 AGAGAGAGTGCTTTCTTCAGAGG - Intronic
1153858445 18:9174058-9174080 GGCCAGACTGCTCTTTTAAGTGG - Intronic
1154181533 18:12143531-12143553 GGCCAGACTGCTTTTTCAAGTGG - Intergenic
1154181737 18:12144569-12144591 GGCCAGACTGCTTTTTAAAGGGG - Intergenic
1154182167 18:12147015-12147037 GGCCAGACTGCTTTTTAAAGGGG + Intergenic
1154182371 18:12148053-12148075 GGCCAGACTGCTTTTTCAAGTGG + Intergenic
1155091337 18:22514718-22514740 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1155117459 18:22783764-22783786 AGCCAGAGTGCTTTGTTAAGGGG - Intergenic
1155464555 18:26120569-26120591 AGCCAGGCTGCTTCCTTAAGTGG + Intergenic
1155842181 18:30659364-30659386 AGCCAGATTGCTTCTTTAAGTGG + Intergenic
1155847860 18:30731573-30731595 AGACAAAGTGCTCTGTTAAATGG + Intergenic
1156139158 18:34084161-34084183 AGCCAGACTGCCTATTTAAGTGG - Intronic
1156664632 18:39390414-39390436 AGTCAAAGTGATTTGTTAAACGG + Intergenic
1157016353 18:43719724-43719746 AGCCAGAGTGCTTCCTTAAGTGG + Intergenic
1157724612 18:49954454-49954476 GGGCAGAGCGCTTTGTGAAGAGG + Intronic
1157778989 18:50420738-50420760 GGCCAGACTGCTTTTTAAAGTGG - Intergenic
1159537005 18:69727115-69727137 TCCCAGAGTGCTTGGTTAACAGG + Intronic
1159730388 18:72019301-72019323 AGCCTGAGTGCTTTCTGCAGAGG - Intergenic
1159988175 18:74870229-74870251 AACCTGAGTGATATGTTAAGAGG + Intronic
1163995977 19:21047834-21047856 AGCCAGAGTGCTTTCTTAAGTGG - Intronic
1164013229 19:21228030-21228052 AACCAGAGTGCTTTGTTAAGTGG + Intronic
1164059071 19:21649830-21649852 AGCCAGAGTGCCTTGTTAAGTGG - Intergenic
1164067593 19:21733705-21733727 AGCCAGAGTGCCTTGTTAAATGG + Intronic
1164232487 19:23302539-23302561 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1164265292 19:23610320-23610342 GGCCAGACTGCTTCTTTAAGTGG - Intronic
1164391163 19:27822436-27822458 GGCCAGACTGCTTGTTTAAGTGG - Intergenic
1165083188 19:33322999-33323021 TGCCAGAGTGCTTTCCTAAGTGG - Intergenic
1165182831 19:33987547-33987569 AGCCAGAAGGCTGTGTCAAGAGG + Intergenic
1166899123 19:46044644-46044666 AGCTAGACTGCTTCTTTAAGTGG + Intronic
925442261 2:3898962-3898984 AGCCAGACTGATTCTTTAAGTGG - Intergenic
925946377 2:8867785-8867807 AGGCAGAGAGCTCTGTTAGGAGG - Intronic
926158933 2:10474658-10474680 GGCCTAAGTGCTTTCTTAAGAGG + Intergenic
926544254 2:14219547-14219569 AATCAGAGTGTTTTGTAAAGGGG - Intergenic
926873224 2:17446179-17446201 AGCCAAAGTGCCTCGTTAAATGG + Intergenic
928883451 2:36122731-36122753 AGCCAGACTGCTTTTTTAAGTGG - Intergenic
929405585 2:41637534-41637556 GGCCAAAGTGCCTTGTTAAATGG + Intergenic
930424362 2:51194280-51194302 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
930455686 2:51605393-51605415 AGCCAGACTGCTTCTTCAAGTGG - Intergenic
930585975 2:53267724-53267746 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
931560476 2:63555490-63555512 AGCCAGAGTGCTTGGTTAAGTGG + Intronic
932874260 2:75433680-75433702 AGCCAAAGTGCTTTGTTAAATGG + Intergenic
933052118 2:77612604-77612626 AGCCAGACTGCTTATTTAAGTGG + Intergenic
933482622 2:82876248-82876270 AGCCAGATTGGTTTTTTAGGTGG + Intergenic
933631361 2:84662791-84662813 AGACAGACTGCTTCCTTAAGTGG + Intronic
934479064 2:94618448-94618470 AGCCAGAGTGCTTTGTTAAGTGG - Intergenic
934479115 2:94618709-94618731 GGCCAGACTGCTTTTTTAGGCGG - Intergenic
934548734 2:95241160-95241182 AGCCAGACTGCTTCTTTAAGTGG + Intronic
934923624 2:98366393-98366415 AGCCAGAGTGCTTTGTTAAGTGG - Intronic
935193839 2:100799367-100799389 AGCAAGAGTCCTTTGGTAAAGGG + Intergenic
935952597 2:108344862-108344884 AGCCAGGGTGCTTCAATAAGTGG - Intergenic
936171577 2:110181286-110181308 AGCCAGACTGCTTCTTTAAGTGG + Intronic
936504350 2:113093246-113093268 AGCCAGAGCTCTTTGTAGAGTGG + Intergenic
936761900 2:115796144-115796166 AGACAGACTGCTTTGTTCTGGGG + Intronic
936837888 2:116729935-116729957 AGCCAAAGTTCTTTCATAAGTGG + Intergenic
936862086 2:117030342-117030364 AGCCAGACTGCTTTTCTAAGTGG + Intergenic
936950826 2:117975706-117975728 TGCCAGAGTGCTTTGTAGTGAGG + Intronic
937001772 2:118474249-118474271 AGCAAGAGTCCTCTGTTCAGGGG - Intergenic
937610584 2:123856088-123856110 AGCCAAAGTACTTTGATAAATGG + Intergenic
937680873 2:124643119-124643141 AACCAGAATGCTTAGTGAAGTGG + Intronic
939398409 2:141660823-141660845 ACCCAGCGCGTTTTGTTAAGTGG + Intronic
939852648 2:147319355-147319377 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
940057078 2:149525110-149525132 AGCCAGAATGTTTCTTTAAGAGG - Intergenic
940057128 2:149525376-149525398 GGCCAGACTGCTTCTTTAAGAGG - Intergenic
940124653 2:150310158-150310180 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
940273325 2:151914978-151915000 GGACAAAGTGCTTTGTTAAATGG - Intronic
940615896 2:156048083-156048105 AGCCAAAGTGCTTCATTAAATGG + Intergenic
941694315 2:168534729-168534751 GGACAAAGTGCTTTGTTAAACGG - Intronic
942856572 2:180555967-180555989 AGCCAGAGTGCTTCGTTAAGTGG + Intergenic
943514107 2:188862913-188862935 AGTCAAAGTGCTTTGTTAAATGG + Intergenic
944035554 2:195290665-195290687 AGCCAGAGTGCTTCGTTAAGTGG + Intergenic
944439355 2:199726903-199726925 AGCCAGAATGCTTCATTAAGTGG - Intergenic
945524010 2:210866106-210866128 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
946648770 2:221868765-221868787 AGCCAGACTGCTTCTTTAAGAGG + Intergenic
946786128 2:223246266-223246288 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1168933469 20:1644067-1644089 AGTCAAAGTGCTTCGTTAAATGG - Intronic
1170011470 20:11728379-11728401 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1170176623 20:13477718-13477740 AGACTGAATGCTTAGTTAAGTGG - Intronic
1170508530 20:17054058-17054080 GGCCAGACTGCTTTTTAAAGTGG - Intergenic
1171022091 20:21594613-21594635 AGCCAAAGTGCTTGATTAAGTGG - Intergenic
1171282141 20:23910008-23910030 GGTCAGACTGCTTTTTTAAGTGG - Intergenic
1175591879 20:60200087-60200109 AGCCAGACTGCTTCGTTAAGTGG - Intergenic
1176522943 21:7838467-7838489 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1176522997 21:7838737-7838759 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
1176977193 21:15335218-15335240 AGCCAGATTGCTCCTTTAAGTGG - Intergenic
1176987609 21:15455864-15455886 AGCCAAACTGCTTCGTTAAGTGG - Intergenic
1177099222 21:16879457-16879479 AGCCAAAGTGCTTTGTTAAATGG + Intergenic
1177332822 21:19683894-19683916 AGCCAAAGTGCTTCGTTAAATGG - Intergenic
1177388156 21:20433586-20433608 AGCCAAAATGCTTCATTAAGTGG + Intergenic
1177956527 21:27605893-27605915 AGCTCAAGTGCTTTGTTAAATGG - Intergenic
1178635472 21:34298470-34298492 ATCCAGAGTTCCTTGTTAGGAGG - Intergenic
1178656963 21:34468479-34468501 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1178657017 21:34468749-34468771 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
1181035798 22:20169258-20169280 AGCAAGAATGCATTATTAAGGGG - Intergenic
1181828800 22:25542085-25542107 AGCCACAGTGATTGGTTCAGGGG + Intergenic
1182194885 22:28506032-28506054 GGCCAGACTGCTTCCTTAAGGGG + Intronic
951884635 3:27512122-27512144 AGACAGAGTGCTTTACTATGGGG - Intergenic
951957721 3:28275610-28275632 AGCCAGAGTGCTTTGTTAAATGG - Intronic
952173578 3:30836340-30836362 TGCCAAAGTACTTTGTGAAGTGG - Intronic
952355082 3:32576491-32576513 GGCCAGAGTGCAATGTTAAATGG - Intergenic
952572354 3:34732161-34732183 AGCCAGAGTGCTTCATTAAGTGG + Intergenic
952574564 3:34759226-34759248 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
952644791 3:35642020-35642042 AAACAGAGTACTTTGTTTAGAGG + Intronic
952694643 3:36250601-36250623 AATCAGAGTGCTTTGTTAAGTGG + Intergenic
953816608 3:46163294-46163316 GGCCAGACTGCTTCTTTAAGCGG - Intergenic
954529194 3:51303909-51303931 AGCCAGAGTGCTTCATTAAGTGG - Intronic
955435941 3:58899180-58899202 AGCCAGACTGTTTTTCTAAGTGG - Intronic
956043044 3:65166734-65166756 AGCCATAGTGATTAGTTTAGAGG + Intergenic
956157864 3:66317605-66317627 AGCCAGACTGCTTATTTAAGTGG - Intronic
956452000 3:69384530-69384552 AGCCAGAGAGCTATGTAATGTGG + Intronic
956477564 3:69639005-69639027 AGCCAAAGTAATTTGTCAAGAGG - Intergenic
958481893 3:94653966-94653988 AGTCAAATTGCTTTGTTAAATGG - Intergenic
958650593 3:96931538-96931560 GGCCAGACTGCTTCTTTAAGTGG - Intronic
958817083 3:98928233-98928255 AGCCAGACTGCTTCTTTAAATGG + Intergenic
959263835 3:104113579-104113601 AACCAGACTGCTTTTTTAAGTGG + Intergenic
959263877 3:104113846-104113868 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
959452049 3:106516803-106516825 GGCCAGAATGCTTTATAAAGTGG + Intergenic
959452770 3:106523506-106523528 GGACAAAGTGCTTTGTTAAATGG + Intergenic
959506718 3:107164426-107164448 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
959957262 3:112252797-112252819 GGTCAGACTGCTTTTTTAAGTGG + Intronic
960680153 3:120239038-120239060 GGCCAGACTGCTTCTTTAAGTGG - Intronic
960764569 3:121111719-121111741 AGCCAGAGTGCTTCGTTAAGTGG - Intronic
961933025 3:130554129-130554151 AGCCAAAGTGCTTTGTTGGATGG + Intergenic
963052959 3:141158111-141158133 GGCCAGACTGCTTTTTTAAGTGG + Intergenic
963057163 3:141194877-141194899 GGCCAGACTGCTTTTTTAAGAGG + Intergenic
963531446 3:146477004-146477026 AGCCAGGGTACTTTGTTAAGTGG + Intronic
963756008 3:149235610-149235632 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
964007705 3:151851768-151851790 AGTCAAAGTGCTTCGTTAAAGGG - Intergenic
964183340 3:153913634-153913656 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
964461538 3:156936378-156936400 AGCCCCAGTTTTTTGTTAAGTGG - Intronic
965288751 3:166849471-166849493 AGCCAGAGAGCTTTGTTAAGTGG - Intergenic
965317737 3:167211982-167212004 AGTCAGACTGCTTTTTTAAGTGG + Intergenic
965342911 3:167512104-167512126 AGATAGAGTGCTTCGTTAAGAGG + Intronic
966071577 3:175885240-175885262 AGCCAGACTGCTTATTTAAATGG - Intergenic
966525544 3:180915031-180915053 AGACAGAGAGATTTGTTCAGGGG - Intronic
966573808 3:181477154-181477176 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
967397481 3:189023984-189024006 AGCCAGACTACTTTTTTAAGTGG - Intronic
967397634 3:189024784-189024806 GGCCAGACTGCTTCCTTAAGAGG - Intronic
967503120 3:190222877-190222899 GGGCAGACTGCTTTTTTAAGTGG - Intergenic
969952577 4:10853603-10853625 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
970031932 4:11685860-11685882 ATCCAGGGTGCTTTGTGAACTGG - Intergenic
970150499 4:13084263-13084285 AGCCAGAGAGCTTTGAGCAGAGG - Intergenic
970952685 4:21775462-21775484 GGACAAAGTGCTTTTTTAAGTGG - Intronic
972022029 4:34327179-34327201 AGCCAGACTGTTTCTTTAAGTGG + Intergenic
972795378 4:42412635-42412657 TGCCAGAGGGCTTTCTTAAACGG - Exonic
972990227 4:44814920-44814942 GGCCAGACAGCTTTTTTAAGTGG - Intergenic
973284819 4:48403457-48403479 GGCCAGACTGCTTCTTTAAGTGG - Intronic
973536800 4:51891029-51891051 AGGCATAGTGCTGTCTTAAGTGG + Intronic
973545080 4:51973236-51973258 AGCCAGAGTGCTTCATTAAGCGG - Intergenic
974130468 4:57748218-57748240 AGCCAGAGTGCCTCATTAAGTGG - Intergenic
974181160 4:58386386-58386408 AGCCAAAGTGCTTTGTTAAATGG - Intergenic
974340007 4:60603331-60603353 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
974760442 4:66266932-66266954 GGACAAAGTGCTTTGTTAAATGG + Intergenic
974913192 4:68148361-68148383 AGCCAGAGTGCTTTGTTAAGTGG - Intergenic
975267472 4:72388041-72388063 AACCAGACTACTTTGTAAAGAGG + Intronic
975297650 4:72752046-72752068 AGCCAAACTGCTTATTTAAGTGG + Intergenic
976238894 4:82932421-82932443 AGCCAGATTGCTTTTTCAAAAGG + Intronic
976375729 4:84342797-84342819 AGCCAGAATGCTTCATTAAGTGG + Intergenic
976769388 4:88634636-88634658 AGCCAAAGTGCTTTGTTAAATGG + Intronic
976850235 4:89536400-89536422 AGCCAGAGTGCTTTTGCAGGGGG - Intergenic
977006339 4:91572413-91572435 GGCCAGACTGATTTTTTAAGTGG - Intronic
977039852 4:92002311-92002333 AGACAGAATGCTTTGTTAAGTGG + Intergenic
977060707 4:92254530-92254552 AGCCAGAGTGCTTTGTTAAGTGG - Intergenic
977084429 4:92575948-92575970 ATCCAGACTGCTTCTTTAAGGGG - Intronic
977086104 4:92600879-92600901 AGCCAGAGTGCTTTGTTAAGAGG - Intronic
977462038 4:97337506-97337528 AGCCAAAGTGCCTTGTTAAATGG + Intronic
977506685 4:97911575-97911597 GGCCAGACTGCTTTTTTAAGTGG + Intronic
977508955 4:97937883-97937905 AGCCAAAGGGCTTCGTTAAATGG - Intronic
977668784 4:99671459-99671481 AGCCAGATTGCTTCTTTAAGTGG + Intergenic
977678649 4:99774557-99774579 AGCCAGACTGCTTATTTCAGTGG + Intergenic
979012397 4:115387983-115388005 AGCCAGAGCTCTTTTGTAAGAGG - Intergenic
979179516 4:117707761-117707783 AGGCAGACTGCTTCTTTAAGTGG + Intergenic
979345713 4:119584512-119584534 AGAGAGAGTACTTTGTTTAGAGG - Intronic
979576097 4:122293954-122293976 GGCCAGACTGCTTCTTTAAGTGG + Intronic
979583830 4:122391362-122391384 GGACAAAGTGCCTTGTTAAGCGG - Intronic
979742452 4:124168146-124168168 AGCCAGAGTGCTTTGTTAAGTGG + Intergenic
980022061 4:127722441-127722463 AGACAGACTGCTTATTTAAGTGG - Exonic
980333656 4:131441028-131441050 GGCCAGAATGCTTCTTTAAGTGG - Intergenic
980517138 4:133877972-133877994 GGCCAGACTGCTTTGTCATGTGG - Intergenic
980787351 4:137572587-137572609 AGTCAAAGTGTTTTGTTAATGGG - Intergenic
980864902 4:138542842-138542864 AGTCAAAGTGCTTTGTTAAACGG + Intergenic
981237603 4:142436404-142436426 AGCGAAAGTGCTTTGTTAAATGG + Intronic
981290623 4:143071111-143071133 AGCAAGAGTACTTTGTTACAAGG - Intergenic
981790889 4:148535597-148535619 AGCCAGATTGCTTTTTTAAAAGG - Intergenic
982660035 4:158195716-158195738 AGCCAGAGTGATTGGTTCAAAGG + Intergenic
982988431 4:162239724-162239746 AGGCAGAATGCTTTCTTCAGAGG - Intergenic
983679482 4:170335912-170335934 AGACACAGTAATTTGTTAAGAGG + Intergenic
984694794 4:182768856-182768878 AGCGAGAGTCCTTTGTAAAGAGG + Intronic
984723391 4:182997983-182998005 AGTCAGAGTGCTTCATTAAATGG + Intergenic
984741318 4:183166451-183166473 AGCCATAGTGTTTTGTAAGGTGG + Intronic
984854043 4:184177512-184177534 AGCCAGAGTGCTTTGTTAAGCGG + Intronic
985345534 4:189001027-189001049 AGCCAGACTGCTTCTTTGAGTGG - Intergenic
986753565 5:10812405-10812427 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
986753610 5:10812670-10812692 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
987040621 5:14058765-14058787 TGCCAGATTGCTTTGCAAAGGGG - Intergenic
987834644 5:23145938-23145960 GGACAAAGTGCTTTGTTAAATGG - Intergenic
987906718 5:24087884-24087906 GGCCAGACTGCTTCTTTAAGTGG + Intronic
987919813 5:24264778-24264800 AGCCAGACTGCTTCTTTAAGCGG + Intergenic
988076527 5:26362258-26362280 AACCAGAGTGCTTCGTTAACTGG - Intergenic
989276741 5:39598694-39598716 AATCAAAGTGCTTTGTTAAACGG - Intergenic
989657415 5:43759877-43759899 AGCCAGATTGTTTCTTTAAGTGG - Intergenic
989676629 5:43981240-43981262 AGCCAAAGTGCTTCATTAAATGG - Intergenic
990620045 5:57549926-57549948 AGCCAAAGTGCTTTGTTAAATGG - Intergenic
990704795 5:58515789-58515811 AGCCAGACTGCTTCTGTAAGAGG + Intergenic
990807422 5:59681430-59681452 AACCATAGTGGTTTGCTAAGGGG - Intronic
990940679 5:61200317-61200339 AGCTAGAGTGCTTTGTTAAGCGG - Intergenic
991143474 5:63273863-63273885 GGCCAGACTGCTTATTTAAGTGG - Intergenic
991364252 5:65852375-65852397 AGACAGACTGCCTTGTCAAGTGG - Intronic
991510929 5:67375712-67375734 GTCCAGAGTGCTTTGGCAAGAGG - Intergenic
992166278 5:74055102-74055124 AGGCAGAATGCTTTGCTAAGTGG + Intergenic
992360217 5:76030240-76030262 AGACAGAATGCTTTGGTCAGAGG + Intergenic
993020365 5:82584461-82584483 AGCCAGACTGCTTATTTAAGTGG - Intergenic
993117207 5:83733482-83733504 GGACAAAGTGCTTTGTTAAATGG - Intergenic
993365477 5:87029927-87029949 AGCCAGACTGCCTCCTTAAGTGG - Intergenic
993587269 5:89746718-89746740 GGACAAAGTGCTTTGTTAAATGG - Intergenic
993792245 5:92222675-92222697 GGCCAGTCTGCTTTTTTAAGTGG - Intergenic
994346828 5:98697361-98697383 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
994696564 5:103079538-103079560 AGCCAAATTGCTTTGTTAAATGG - Intergenic
994843117 5:104951538-104951560 AGCCAAAGTTCTTTGTTAAATGG - Intergenic
995428589 5:112050163-112050185 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
996005839 5:118419929-118419951 AGCCAGACTGTTTCTTTAAGTGG + Intergenic
996182084 5:120431896-120431918 AGCCAGACTGCTTATTTAAGTGG - Intergenic
996527215 5:124492036-124492058 AGTCAAAGTGCTTCGTTAAAGGG - Intergenic
996639134 5:125730910-125730932 AGCCAAATTGCTTGGTTAAATGG + Intergenic
996778578 5:127159588-127159610 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
997205008 5:132043093-132043115 GGCCAGACTGCTTTCTTAAGTGG - Intergenic
999666195 5:153916368-153916390 AGCCAGACTGCTTCTTTAAGCGG - Intergenic
999666298 5:153916889-153916911 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1000031578 5:157406552-157406574 GGCCAGACTGCTTTTTTAAGTGG + Intronic
1000031627 5:157406827-157406849 TGCCAGACTGCTTTTTTAAGTGG + Intronic
1000802572 5:165747136-165747158 AACCAGAGAGATTTTTTAAGAGG + Intergenic
1001739076 5:174035079-174035101 AGCCAAAGTGCTTTGTTAAATGG - Intergenic
1002967295 6:1978750-1978772 AGCCAGATTGTTTTTTTAAGTGG + Intronic
1004760171 6:18657022-18657044 ATTCAAAGTGCTTTGTTAAATGG + Intergenic
1005170671 6:22980943-22980965 AGTCAAAGTGCTTTGTTAAATGG + Intergenic
1005173860 6:23021714-23021736 AGCCAGACTGATTTGCTAAGTGG - Intergenic
1005606157 6:27479467-27479489 AGCGAGAGTTCTTTTTTAAAAGG + Intergenic
1006712215 6:36083852-36083874 AGCCAGAGTGCTTCGTTAGGTGG + Intronic
1008298529 6:49806125-49806147 TGCCAGACTGCTTCTTTAAGTGG + Intergenic
1010411711 6:75568585-75568607 AGCCAAAGTGCCTTGTTAAATGG + Intergenic
1011370630 6:86633520-86633542 GGCCAGACTGCTTTTTAAAGTGG - Intergenic
1011377593 6:86706618-86706640 AGCCAGACTGATTTTTTAAGTGG - Intergenic
1012142687 6:95643204-95643226 AGCCAGACTACTTCTTTAAGTGG + Intergenic
1012315103 6:97775455-97775477 AGCCAGAGTGCTTCATTAAGTGG + Intergenic
1012616349 6:101283714-101283736 GGCCAGACTGCTTTTTAAAGTGG + Intergenic
1014369216 6:120584118-120584140 GGACAAAGTGCTTTGTTAAATGG - Intergenic
1014484703 6:121984724-121984746 AGTCAAAGTGCTTTGTTAAATGG - Intergenic
1014564386 6:122930326-122930348 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1015116357 6:129654091-129654113 AGCCACTGAGCTTTGTTTAGAGG + Intronic
1015197152 6:130536678-130536700 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1015587412 6:134789880-134789902 AGACAGAGTGCTTTATTAAGTGG + Intergenic
1015660112 6:135566067-135566089 AGCCAAAGTGCTTCATTAATTGG - Intergenic
1016423733 6:143912731-143912753 ATCCAGACTGCTTCTTTAAGTGG - Intronic
1017100164 6:150842233-150842255 AGCAAGAATGCTTTCTCAAGCGG + Exonic
1017994547 6:159520853-159520875 AGCCAGACTGCTTTTTCACGTGG - Intergenic
1019228002 6:170531216-170531238 AGCTGGGCTGCTTTGTTAAGTGG - Intergenic
1019967381 7:4510836-4510858 GGCCAGATTGCTTTTTTCAGAGG + Intergenic
1020633728 7:10671897-10671919 GGACAAAGTGCTTTGTTAAATGG - Intergenic
1020867960 7:13590631-13590653 AGCCAGACTGCTTCTTCAAGTGG - Intergenic
1021520972 7:21538620-21538642 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
1023207246 7:37763906-37763928 AGCCAAAGTGCTTCGTTAAATGG + Intronic
1024206974 7:47171833-47171855 AGCCAGACTGTTTTCTAAAGTGG - Intergenic
1024590033 7:50872994-50873016 AGCCAGAGTGTTTTGTTAAGTGG + Intergenic
1024661822 7:51502786-51502808 AGCCAGAATTCTATGTGAAGTGG - Intergenic
1024795273 7:53012506-53012528 AGCCAGACTCCTTCTTTAAGTGG - Intergenic
1024990497 7:55231568-55231590 AGCCAGACTGCTTCTTTAAGTGG - Intronic
1024990552 7:55231832-55231854 GGCCAGACTGCTTCTTTAAGTGG - Intronic
1025756881 7:64352406-64352428 GGCTAGACTGCTTTCTTAAGTGG - Exonic
1027627800 7:80565592-80565614 AGTCAGACTGCTTCTTTAAGTGG - Intronic
1027654386 7:80911969-80911991 AGCTTGAGTGTTTTGTTAATCGG - Intronic
1028048971 7:86158769-86158791 AGTCAAAGTGCTTTGTTAAATGG + Intergenic
1029052060 7:97699974-97699996 GGCCAGACTGCTTTTTAAAGCGG + Intergenic
1029780135 7:102723229-102723251 AGACAGACTGCCTTGTCAAGTGG + Intergenic
1030289546 7:107858625-107858647 ATCTAGAGTGGTTTGTTGAGTGG - Intergenic
1030438264 7:109552566-109552588 AGCCAGTCTGCTTCTTTAAGCGG + Intergenic
1030692130 7:112546929-112546951 AGCCAGAGTGCTTTATTAAGCGG - Intergenic
1030696172 7:112588006-112588028 GGCCAGACTGCTTCTTTAAGCGG + Intergenic
1030759423 7:113332095-113332117 AGTCAAAGTGCTTCGTTAAGTGG + Intergenic
1030830217 7:114210896-114210918 GGCCAGACTGCTTCTTTAAGTGG - Intronic
1031254273 7:119428222-119428244 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1031291946 7:119949314-119949336 GGCCAGACTGCTTTTTTAAGCGG + Intergenic
1031804645 7:126292994-126293016 CGACAAAGTGCTTTGTTAAATGG + Intergenic
1032926759 7:136614792-136614814 GGACAAAGTGCTTTGTTAAATGG - Intergenic
1033989459 7:147265656-147265678 AGTCAAAGTGCTTTGTTAAATGG + Intronic
1034330283 7:150276813-150276835 AGCCAGGGGGCCCTGTTAAGTGG - Intronic
1034364430 7:150534121-150534143 GGCCAGACTGCTTTTTAAAGTGG - Intergenic
1034667762 7:152833035-152833057 AGCCAGGGGGCCCTGTTAAGTGG + Intronic
1035818661 8:2567668-2567690 AGTCAGAATGCCTTGTTTAGAGG - Intergenic
1036584337 8:10109174-10109196 AGCCAAAGTGCTTTTTTTAAAGG - Intronic
1036648174 8:10625194-10625216 ACCCAGCATGTTTTGTTAAGAGG - Intronic
1036684324 8:10899165-10899187 AGCCAGTGTGTTTTGCTAGGGGG + Intronic
1038073755 8:24046716-24046738 AGTCAAAGTGCTTTGTTAAATGG + Intergenic
1039265214 8:35816341-35816363 AGCCAAAGTTCTTCGTTAAATGG + Intergenic
1039478149 8:37852233-37852255 GGCCAGAGTTCTTTGTAGAGGGG + Intergenic
1039637059 8:39179016-39179038 AGCCAGACTGCTTCTTTAAGCGG - Intronic
1039820518 8:41130160-41130182 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1040372344 8:46789132-46789154 GGCTAGACTGCTTTCTTAAGTGG - Intergenic
1040959832 8:53019562-53019584 AGTCAAAGTGCTTCGTTAAATGG + Intergenic
1041021331 8:53642217-53642239 AGCCAAAGTGCTTTGTTAAATGG - Intergenic
1041623437 8:59999452-59999474 GGCCAGACTGCTTCCTTAAGTGG + Intergenic
1041743136 8:61177479-61177501 AATCAAAGTGCTTTGTTAAATGG + Intronic
1041747538 8:61224670-61224692 AATCAAAGTGCTTTGTTAAATGG - Intronic
1041972561 8:63760568-63760590 AGCCAGACTGTTTCTTTAAGTGG - Intergenic
1043092623 8:75924519-75924541 AGCCAGACTGCTTTTTTAAGCGG + Intergenic
1043198398 8:77330256-77330278 AGGCAGAGTGCTTGGATGAGTGG + Intergenic
1043233392 8:77830564-77830586 AGCCAAAGTGCTTTGGTAAATGG + Intergenic
1043304941 8:78782712-78782734 AGCCAGAGTGCTTCATTAAGTGG - Intronic
1043363138 8:79499327-79499349 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
1044038587 8:87337198-87337220 AGCCAAAGTGCCTTGTTAAATGG - Intronic
1044113344 8:88303460-88303482 AGCCAGACTGCTTCTTTAAGTGG + Intronic
1044203004 8:89458208-89458230 AGACAGACTGCCTTGTCAAGTGG + Intergenic
1044450926 8:92335369-92335391 AGCCAGACTGTTTCTTTAAGTGG - Intergenic
1044505036 8:93007001-93007023 AGCCAGAGTGCTTCATTAAGTGG + Intronic
1044873392 8:96641934-96641956 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
1044873435 8:96642189-96642211 AGCCAGACTGCTTCTGTAAGCGG - Intergenic
1045490876 8:102668205-102668227 AGCCAGATTGCTTTCCTAAGTGG - Intergenic
1045595535 8:103650662-103650684 GGCCAGACTGCTTCTTTAAGTGG - Intronic
1045732916 8:105263088-105263110 AGCCAGACTGATTCTTTAAGTGG - Intronic
1046170503 8:110498822-110498844 AGACTGAGTGCTTAGTAAAGGGG - Intergenic
1046601959 8:116327166-116327188 AGACAGACTGCCTTCTTAAGTGG + Intergenic
1046657655 8:116912864-116912886 AGTCAGAGTGCTTCCTTAAACGG - Intergenic
1046702773 8:117419295-117419317 AGCCAGAGTGCTTTGTTAAATGG + Intergenic
1046837879 8:118823072-118823094 TGACAGAGTCCTTTGTGAAGTGG + Intergenic
1046911847 8:119637025-119637047 AGCCAGAGTAATATATTAAGAGG + Intronic
1046986815 8:120397604-120397626 AGCCACACTGCTTCTTTAAGTGG + Intronic
1047369501 8:124244948-124244970 AGCCAGAGCTCTTTCGTAAGAGG + Intergenic
1047739630 8:127796107-127796129 TCCCAGAGGGATTTGTTAAGTGG + Intergenic
1047778282 8:128091432-128091454 AGCCAGGGTGCTGTGTGATGTGG - Intergenic
1048395498 8:134010548-134010570 AGCCAGGGTTCTTTGGTAAGTGG + Intergenic
1050393151 9:5167744-5167766 AGCCAGACTGCTTATTTAAGTGG + Intronic
1050395179 9:5188189-5188211 AGCTAGATTGCTTATTTAAGTGG - Intergenic
1050441208 9:5665927-5665949 AGCCAGACTGCTTCTTTAAGTGG - Intronic
1050660804 9:7880515-7880537 AGTCAAAGTGCTTTGTTAAATGG + Intronic
1051913871 9:22185121-22185143 GGCCAGACTGCTATTTTAAGTGG + Intergenic
1052094733 9:24370056-24370078 TGCCAGATTGCTTTTTTAAATGG - Intergenic
1052369300 9:27645814-27645836 AGTCAAAGTGCTTTGTTAAGTGG + Intergenic
1052378288 9:27741988-27742010 GGCCAGACTGCTTTTTTAAGTGG - Intergenic
1052387097 9:27835363-27835385 AGCCAGAGTGCCTTGTGAAGTGG - Intergenic
1052420856 9:28241621-28241643 AGCCAAAGTGCCTTGTTAAATGG + Intronic
1052702957 9:31960091-31960113 GGCCAGAGTGCTTTTTTAAGTGG + Intergenic
1053678713 9:40464856-40464878 GGCCAGACTGCTTTTTTAGGTGG + Intergenic
1053678765 9:40465117-40465139 AGCCAGAGTGCTTTGTTAAGTGG + Intergenic
1053928698 9:43093209-43093231 GGCCAGACTGCTTTTTTAGGCGG + Intergenic
1053928750 9:43093470-43093492 AGCCAGAGTGCTTTGTTAAGTGG + Intergenic
1054284958 9:63159825-63159847 AGCCAGAGTGCTTTATTAAGTGG - Intergenic
1054285010 9:63160086-63160108 GGCCAGACTGCTTTTTTAGGTGG - Intergenic
1054291791 9:63300394-63300416 GGCCAGACTGCTTTTTTAGGTGG + Intergenic
1054291843 9:63300655-63300677 AGCCAGAGTGCTTTGTTAAGTGG + Intergenic
1054389809 9:64604937-64604959 GGCCAGACTGCTTTTTTAGGTGG + Intergenic
1054389861 9:64605198-64605220 AGCCAGAGTGCTTTGTTAAGTGG + Intergenic
1054505853 9:65911178-65911200 AGCCAGAGTGCTTTGTTAAGTGG - Intergenic
1054505905 9:65911439-65911461 GGCCAGACTGCTTTTTTAGGTGG - Intergenic
1055208611 9:73762747-73762769 GGCCAGTCTGCTTTATTAAGTGG + Intergenic
1055224871 9:73984114-73984136 AGCCAGAGAACTTTTTTAAGTGG + Intergenic
1055240508 9:74180283-74180305 AGGCAGGGGGCTTTGTAAAGGGG - Intergenic
1055343269 9:75308453-75308475 AGCCACACTGCTTCTTTAAGAGG - Intergenic
1055343564 9:75310635-75310657 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
1055509753 9:76984541-76984563 AGCCAGATTGCTTCTTTAAGTGG - Intergenic
1055740352 9:79381688-79381710 AGACAGAGTGCTATGTATAGAGG - Intergenic
1056127949 9:83555109-83555131 GGCCAGATTGTTTTTTTAAGTGG - Intergenic
1056398779 9:86206692-86206714 ATCGAGATTGTTTTGTTAAGTGG + Intergenic
1056545197 9:87607063-87607085 AGCCAGAGTTCTCAGTTACGAGG - Intronic
1058200004 9:102027735-102027757 AGCCAGACTGCTTCCTTAAGTGG - Intergenic
1058514159 9:105752322-105752344 AGCCAGACTGCTTTTTTAAGCGG + Intronic
1059023306 9:110598966-110598988 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1059262651 9:112993545-112993567 AGCTAGAGTGATTTGTTAGGTGG - Intergenic
1059319322 9:113455828-113455850 AGCTGGAATGCTTTGTTAAGTGG - Intronic
1059503627 9:114778132-114778154 ACCCAGAGTGCTTTAATCAGGGG + Intergenic
1059509938 9:114835919-114835941 AGCCAGACTGCTTCTTTAAGTGG - Intergenic
1060184287 9:121554412-121554434 AGCAAAAGTGCTGTGTTAAAGGG - Intergenic
1060321056 9:122561834-122561856 AGCCAAAGTGCTTCATTAAATGG - Intergenic
1061609684 9:131738510-131738532 AGCCAGGGTGCTTTTCTCAGGGG - Intronic
1185952544 X:4452278-4452300 AGTCAAAGTGCTTCGTTAAATGG + Intergenic
1186593239 X:10953332-10953354 AGCCAGACTGCTTCTTTCAGTGG + Intergenic
1187646189 X:21349266-21349288 AGCCAGACTGCTTCTTTAAGTGG + Intergenic
1188362535 X:29273561-29273583 AGCCAAAGCGCTTTGTCCAGTGG + Intronic
1188669838 X:32868897-32868919 AGCCAGAGTGCTTCCTTAAGTGG + Intronic
1188723485 X:33551684-33551706 GGCCAGACTGCTTCTTTAAGCGG - Intergenic
1188793747 X:34437594-34437616 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1189449213 X:41111647-41111669 AAGCAGACTGCTTTGTTCAGAGG + Intronic
1189581705 X:42413852-42413874 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1189652261 X:43203305-43203327 AGCCAGACTGCTTCTTCAAGTGG - Intergenic
1189854931 X:45214547-45214569 GGCCAGACTGCTTTGGTAAGTGG + Intergenic
1189940099 X:46112641-46112663 AGCCAGAGTGCTTCATTAAGTGG - Intergenic
1189940148 X:46112895-46112917 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1190313585 X:49134763-49134785 AGCTAGAATATTTTGTTAAGTGG + Intergenic
1190600674 X:52089183-52089205 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1191065488 X:56343110-56343132 AGCCAGACTGCTTCTTTAAGCGG - Intergenic
1191078829 X:56487288-56487310 AGCCAGACTTCTTTTTTAAGTGG - Intergenic
1191078860 X:56487538-56487560 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1191209587 X:57871289-57871311 TGCCAGACTGCTTCTTTAAGTGG - Intergenic
1191209733 X:57872090-57872112 GGCCAGAGTGCTGCTTTAAGTGG - Intergenic
1191743802 X:64464376-64464398 GGCCAGAATGCTTTTTTAAGTGG - Intergenic
1191743885 X:64464924-64464946 GGCCAGAATGCTTTTTAAAGTGG - Intergenic
1191768786 X:64732820-64732842 AGCCAGAGTGCTTCACTAAGTGG - Intergenic
1191775398 X:64808017-64808039 AGCCAAAGTGCCTCGTTAAATGG + Intergenic
1191810061 X:65176541-65176563 GGACAGACTGCTTTCTTAAGTGG + Intergenic
1191815560 X:65241042-65241064 AGCCAGTCTGCTTCCTTAAGTGG - Intergenic
1191832321 X:65429243-65429265 AGCCAGATTGCTTCTTTAAGTGG - Intronic
1191832369 X:65429507-65429529 GGCCAGACTGCTTCTTTAAGTGG - Intronic
1191876929 X:65807003-65807025 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1191889306 X:65924837-65924859 AGCCAGATTGCTTTCTTAAGTGG - Intergenic
1191922437 X:66270994-66271016 GGCCAGACTGCTTTTTAAAGTGG + Intergenic
1191993855 X:67068680-67068702 GGCCAGACTGCTTGTTTAAGTGG + Intergenic
1192292830 X:69815570-69815592 GGCCAGAGTGCTTCTTTAATTGG + Intronic
1192723351 X:73723608-73723630 AGCCAGCCTGCTTCTTTAAGTGG - Intergenic
1192822017 X:74656152-74656174 AGCCAGACTGCTTCTTTAAATGG - Intergenic
1192872064 X:75194389-75194411 AGCCAGAGTGCTTTGTAGGGTGG + Intergenic
1192897595 X:75460171-75460193 GGCCAGACTGCTTCTTTAAGTGG + Intronic
1192897647 X:75460436-75460458 AGCCAGACTGCTTCTTTAAGTGG + Intronic
1192923632 X:75734019-75734041 GGCCAGACTGCTTTTTTAAGTGG - Intergenic
1192930198 X:75798982-75799004 TGCCAAGGTGCTTTGTTAAATGG - Intergenic
1192934742 X:75848121-75848143 AGCCAAAGTGCTTTGTAGGGTGG + Intergenic
1193005893 X:76617873-76617895 GGCCAGACTGCTTTTTTAAGCGG + Intergenic
1193039355 X:76987980-76988002 AGACAAAGTGCTTTGTTAAATGG + Intergenic
1193176473 X:78400679-78400701 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1193176524 X:78400944-78400966 AGCCAGACTGCTTCTTTAAGCGG + Intergenic
1193274505 X:79570250-79570272 GGCCAGACTGCTTCGTTAAGTGG - Intergenic
1193295893 X:79830551-79830573 GGCCAGACTGCTTTTTAAAGTGG - Intergenic
1193458096 X:81755448-81755470 AGCCAGACTGCTTCTTTGAGTGG + Intergenic
1193478405 X:81996255-81996277 GGCCAGATTGCTTTTTTAGGTGG + Intergenic
1193533584 X:82686320-82686342 AGCCAGAGTGCTTTGTTAAGTGG - Intergenic
1193739759 X:85203306-85203328 GGCCAGACTGCTTTTTTAAGTGG - Intergenic
1193916985 X:87378098-87378120 AGCCAGAGGGCTTTTATGAGAGG - Intergenic
1193933043 X:87581102-87581124 GGCCAGACTGCTTTTTTAAGTGG + Intronic
1194188579 X:90807325-90807347 GGCCATACTACTTTGTTAAGTGG - Intergenic
1194281367 X:91958022-91958044 GGCCAGACTGCTTCTTTAAGTGG - Intronic
1194286841 X:92020691-92020713 AGTCAAAGTGCTTTGTTAAACGG + Intronic
1194444912 X:93975666-93975688 AGCCAGATTGCTTATTTAAGTGG - Intergenic
1194537239 X:95119927-95119949 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1194580608 X:95666221-95666243 AGCCAGACTGCTTCTTTAAATGG + Intergenic
1194594031 X:95836128-95836150 GGCCAGACTGCTTTTTTAACTGG - Intergenic
1194608122 X:96006333-96006355 GGCCAGACTGCTTCTTTAAGAGG + Intergenic
1194635561 X:96342186-96342208 GGCCAGACTACTTTTTTAAGTGG - Intergenic
1194930457 X:99881150-99881172 AGCCAGAGTACTTCATTAAGCGG + Intergenic
1194953346 X:100152791-100152813 AGCCAGATTGCTCCTTTAAGTGG - Intergenic
1194953512 X:100153590-100153612 GGCCAGACTGCTTCTTTAAGTGG - Intergenic
1195148568 X:102043235-102043257 GGCCAGAATGCTGTTTTAAGTGG + Intergenic
1195153476 X:102097709-102097731 AGCCAGAGTGCCTCCTTAAGTGG + Intergenic
1195361307 X:104085701-104085723 GGCCAGACTGCTTTTTTAAGTGG - Intergenic
1195911225 X:109890277-109890299 AGCCAGTGTGCTGTGTCAACCGG - Intergenic
1196152767 X:112392818-112392840 GGCCAGATTGCTTTTTAAAGAGG - Intergenic
1196228052 X:113189309-113189331 GGCCTGACTGCTTTGTTAAGCGG - Intergenic
1196229257 X:113202622-113202644 AGCCAGAGTGTTTCAGTAAGCGG - Intergenic
1196284460 X:113863570-113863592 AGACAGAGTGCTTCATTAAGCGG - Intergenic
1196308580 X:114133812-114133834 AGGCAGAGTCCTCTGTGAAGTGG - Intergenic
1196381842 X:115099085-115099107 AGCCAGAGTGCTTTGTTAAGCGG + Intergenic
1196558966 X:117123328-117123350 AGCCAGACTGCTTCATTAAGGGG + Intergenic
1197049501 X:122042213-122042235 AGCCAAAGTGCTTCATTAAATGG - Intergenic
1197122183 X:122906104-122906126 GGCCAGACTGCTTTATAAAGTGG + Intergenic
1197356773 X:125445109-125445131 AGCCAGAGTGCTTCATTAAGTGG + Intergenic
1197413830 X:126150668-126150690 GGCCAGACTGCTTCTTTAAGCGG - Intergenic
1197428086 X:126323317-126323339 GGCCAGACTGCTTCTTTAAGCGG + Intergenic
1197455272 X:126670947-126670969 AGCCAGACTGCTTCTGTAAGTGG + Intergenic
1197897325 X:131329000-131329022 AACCAGATTGCTTTCTTGAGTGG + Intronic
1198786309 X:140292192-140292214 AGCCAGACTGCTGATTTAAGTGG - Intergenic
1198841401 X:140861357-140861379 AGCCCGAGTGCTTCATTAAGTGG + Intergenic
1199079559 X:143561526-143561548 AACCAGACTGCTTATTTAAGTGG + Intergenic
1199102587 X:143820993-143821015 AGCCAGACTGTTTTCTAAAGTGG - Intergenic
1199308179 X:146292377-146292399 AGCCAGAGTGCTTCCTTAAGTGG - Intergenic
1199310896 X:146318216-146318238 AGCCAGAGTGCTTTCTTAAGTGG + Intergenic
1199478616 X:148273634-148273656 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1199589285 X:149451264-149451286 GGCCAGACTGCTTCTTTAAGCGG - Intergenic
1200321702 X:155196573-155196595 AGCCAGAGTGCTTCCTTAAGTGG - Intergenic
1200344623 X:155435955-155435977 GGCCAGACTGCTTCTTTAAGTGG + Intergenic
1200529772 Y:4319861-4319883 AGCCAGAGTGCTTCATTAAGCGG + Intergenic
1200598956 Y:5182678-5182700 GGCCAGACTGCTTCTTTAAGTGG - Intronic
1200604383 Y:5245251-5245273 AGTCAAAGTGCTTTGTTAAACGG + Intronic
1200639357 Y:5699304-5699326 ATCCAGGGTACTTTGTTGAGTGG - Intronic
1200879160 Y:8194143-8194165 AGACAGACTGCCTTCTTAAGTGG + Intergenic
1200901090 Y:8432854-8432876 AGCCAGAGTCCTGTCTTAAAGGG - Intergenic
1200905758 Y:8480477-8480499 AACTAGAGTGCGTTCTTAAGTGG - Intergenic
1201958398 Y:19650897-19650919 AGCCAGACTTCTTCTTTAAGTGG - Intergenic
1202256732 Y:22929042-22929064 TGCTAGACTGCTTTCTTAAGTGG - Intergenic
1202409723 Y:24562795-24562817 TGCTAGACTGCTTTCTTAAGTGG - Intergenic
1202461060 Y:25107282-25107304 TGCTAGACTGCTTTCTTAAGTGG + Intergenic