ID: 977060707

View in Genome Browser
Species Human (GRCh38)
Location 4:92254530-92254552
Sequence AGCCAGAGTGCTTTGTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060707_977060721 29 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060721 4:92254582-92254604 TGGGGGAAACCCACTGGTCTGGG No data
977060707_977060716 10 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060716 4:92254563-92254585 GGAGGGGGTGTTCTGCACTTGGG No data
977060707_977060712 -5 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG No data
977060707_977060717 11 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060717 4:92254564-92254586 GAGGGGGTGTTCTGCACTTGGGG No data
977060707_977060718 12 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060718 4:92254565-92254587 AGGGGGTGTTCTGCACTTGGGGG No data
977060707_977060711 -6 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060707_977060719 23 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060719 4:92254576-92254598 TGCACTTGGGGGAAACCCACTGG No data
977060707_977060709 -8 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data
977060707_977060715 9 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060715 4:92254562-92254584 TGGAGGGGGTGTTCTGCACTTGG No data
977060707_977060720 28 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060720 4:92254581-92254603 TTGGGGGAAACCCACTGGTCTGG No data
977060707_977060710 -7 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060710 4:92254546-92254568 TCTGGCTGTCCCTTTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060707 Original CRISPR AGCCAGAGTGCTTTGTTAAG TGG (reversed) Intergenic