ID: 977060708

View in Genome Browser
Species Human (GRCh38)
Location 4:92254542-92254564
Sequence GCACTCTGGCTGTCCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060703_977060708 14 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060708 4:92254542-92254564 GCACTCTGGCTGTCCCTTTGTGG No data
977060706_977060708 -10 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060708 4:92254542-92254564 GCACTCTGGCTGTCCCTTTGTGG No data
977060701_977060708 15 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060708 4:92254542-92254564 GCACTCTGGCTGTCCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977060708 Original CRISPR GCACTCTGGCTGTCCCTTTG TGG Intergenic