ID: 977060709

View in Genome Browser
Species Human (GRCh38)
Location 4:92254545-92254567
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060706_977060709 -7 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data
977060707_977060709 -8 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data
977060703_977060709 17 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data
977060701_977060709 18 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060709 4:92254545-92254567 CTCTGGCTGTCCCTTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type