ID: 977060711

View in Genome Browser
Species Human (GRCh38)
Location 4:92254547-92254569
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977060707_977060711 -6 Left 977060707 4:92254530-92254552 CCACTTAACAAAGCACTCTGGCT 0: 17
1: 21
2: 42
3: 158
4: 432
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060703_977060711 19 Left 977060703 4:92254505-92254527 CCGTCAGGGGCACAGGATCTGGG No data
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060706_977060711 -5 Left 977060706 4:92254529-92254551 CCCACTTAACAAAGCACTCTGGC No data
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data
977060701_977060711 20 Left 977060701 4:92254504-92254526 CCCGTCAGGGGCACAGGATCTGG No data
Right 977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr