ID: 977063423 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:92284223-92284245 |
| Sequence | ATGGAGAAGTAGGGGGTGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977063423_977063429 | -9 | Left | 977063423 | 4:92284223-92284245 | CCTACCACCCCCTACTTCTCCAT | No data | ||
| Right | 977063429 | 4:92284237-92284259 | CTTCTCCATGAAAATAGTGCAGG | No data | ||||
| 977063423_977063430 | -6 | Left | 977063423 | 4:92284223-92284245 | CCTACCACCCCCTACTTCTCCAT | No data | ||
| Right | 977063430 | 4:92284240-92284262 | CTCCATGAAAATAGTGCAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977063423 | Original CRISPR | ATGGAGAAGTAGGGGGTGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||