ID: 977063423

View in Genome Browser
Species Human (GRCh38)
Location 4:92284223-92284245
Sequence ATGGAGAAGTAGGGGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977063423_977063429 -9 Left 977063423 4:92284223-92284245 CCTACCACCCCCTACTTCTCCAT No data
Right 977063429 4:92284237-92284259 CTTCTCCATGAAAATAGTGCAGG No data
977063423_977063430 -6 Left 977063423 4:92284223-92284245 CCTACCACCCCCTACTTCTCCAT No data
Right 977063430 4:92284240-92284262 CTCCATGAAAATAGTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977063423 Original CRISPR ATGGAGAAGTAGGGGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr