ID: 977064847

View in Genome Browser
Species Human (GRCh38)
Location 4:92302552-92302574
Sequence CTTGAGATGGTGAAGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 413}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977064839_977064847 30 Left 977064839 4:92302499-92302521 CCACATTAAAGGACTGGACACTA 0: 1
1: 0
2: 1
3: 4
4: 119
Right 977064847 4:92302552-92302574 CTTGAGATGGTGAAGGAGAGTGG 0: 1
1: 0
2: 3
3: 38
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977064847 Original CRISPR CTTGAGATGGTGAAGGAGAG TGG Intronic
900793687 1:4694986-4695008 CTTGAGAAGGTGGTGGGGAGAGG + Intronic
901554990 1:10024622-10024644 CTTGAGAAGGTGAGAGAGAAAGG + Intergenic
901948886 1:12725643-12725665 CCTGAGAGGTTTAAGGAGAGGGG + Exonic
902718886 1:18291273-18291295 CTTGGGATGGGCCAGGAGAGAGG - Intronic
903240147 1:21977238-21977260 CTTATGATGGAGCAGGAGAGTGG + Intronic
903243896 1:22001873-22001895 CTTATGATGGAGCAGGAGAGTGG + Intronic
903528836 1:24013942-24013964 CATGAGATGGCTAAGAAGAGGGG + Intergenic
903801916 1:25975221-25975243 ATTGAGATGGAGAAGAATAGAGG - Intronic
904468230 1:30720304-30720326 GTGGAGAGGGTGAAGGAGATGGG - Intronic
904608701 1:31713560-31713582 CTTGAGATGGGGAAGGGGAATGG + Intergenic
904915837 1:33970234-33970256 CTTCAGATGGTGAAGAAAGGTGG + Intronic
905696136 1:39975064-39975086 ATTGAGATGGAGAGGGAGAGGGG + Intergenic
906477865 1:46181964-46181986 CTGGAGATGGTGGTGGAGATAGG + Intronic
906564779 1:46791153-46791175 CTGGATATGGTGAAAGTGAGGGG - Intronic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
907794179 1:57698192-57698214 CTTGAGAGGGTGAAGAAGGAGGG - Intronic
909782629 1:79565437-79565459 CTTGAAGTGCTCAAGGAGAGTGG + Intergenic
910107621 1:83648401-83648423 CGTGAGTATGTGAAGGAGAGAGG + Intergenic
910912161 1:92247567-92247589 CTTGAGAGTGAGATGGAGAGTGG + Intronic
911129357 1:94373425-94373447 CATCAGAAGGGGAAGGAGAGGGG - Intergenic
911289858 1:96044242-96044264 CTTGACATGGTCTAGTAGAGAGG + Intergenic
913260077 1:116989831-116989853 CCTCAGATGGTGAGGGTGAGGGG - Exonic
913370693 1:118095823-118095845 CATGAAATAGTGAAGGACAGAGG + Intronic
914202646 1:145499820-145499842 CTTGAGGTGGTGAGGGTAAGAGG - Intergenic
914236576 1:145817748-145817770 CTTGAGGTGGTGAGGGTAAGAGG - Intronic
914481769 1:148072971-148072993 CTTGAGGTGGTGAGGGTAAGAGG - Intergenic
914696598 1:150088219-150088241 GATGGGATGGTGAAGGATAGGGG - Intronic
914900555 1:151709086-151709108 GTTGAGATGGAGGAGGAGAGGGG + Intronic
915903410 1:159862126-159862148 CTGGAGGTGGGGTAGGAGAGGGG - Intronic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916778074 1:167990056-167990078 TTTGAGCTGGTTAAGGAGAAAGG + Intronic
917264902 1:173210493-173210515 AGGAAGATGGTGAAGGAGAGTGG + Intergenic
917372040 1:174303942-174303964 CATGGGATGTTGAATGAGAGTGG + Intronic
917511257 1:175671027-175671049 CATGACATGGAGATGGAGAGAGG + Intronic
918107615 1:181427389-181427411 GTTGAGATGGAGAAGGAATGAGG - Intronic
918107634 1:181427469-181427491 CTTGAGATGGGGAAGGGTTGAGG - Intronic
919964553 1:202509330-202509352 AATGAGAAAGTGAAGGAGAGAGG + Intronic
920730732 1:208481665-208481687 GTTGGGATGGTAGAGGAGAGAGG - Intergenic
920922289 1:210308201-210308223 CTTTGGATGGTGCAGGGGAGTGG - Intergenic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
922355359 1:224770023-224770045 CTTGAGAAGTTAAAAGAGAGAGG + Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922910392 1:229210923-229210945 GTTGAGATGGTGGAGGGCAGAGG - Intergenic
924079370 1:240378010-240378032 GTTTAGATGGGGAAGGAGTGGGG - Intronic
924502544 1:244651217-244651239 GTTGAGTTGGTTAGGGAGAGAGG - Intergenic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
924791149 1:247249491-247249513 TTATATATGGTGAAGGAGAGGGG + Intergenic
1066270461 10:33817854-33817876 CTTTAGATGGAGAAAGAAAGGGG - Intergenic
1069248323 10:66236869-66236891 CTTTAGGAGGTCAAGGAGAGAGG + Intronic
1070397684 10:76025780-76025802 CTGGGGCTGGTGAAGGAGATGGG - Intronic
1070422416 10:76250174-76250196 CTTCAGCTGGAGAAGGGGAGAGG + Intronic
1070837858 10:79462030-79462052 ATTGAGAGGGAGAGGGAGAGGGG + Intergenic
1070854230 10:79593776-79593798 CCTGAGATGGTGCAGGAGAATGG - Intergenic
1071255797 10:83870530-83870552 CTGGAAATGGTGAAAGAGATTGG - Intergenic
1071547383 10:86538857-86538879 CATAAGATGGGGAGGGAGAGAGG - Intergenic
1072127075 10:92456185-92456207 AATGAGGTAGTGAAGGAGAGAGG - Intronic
1072738232 10:97893746-97893768 TTAGAGATGGTGGAAGAGAGAGG - Intronic
1073249127 10:102111145-102111167 CTGGAGGAAGTGAAGGAGAGAGG + Intronic
1073315659 10:102578935-102578957 CTCGTGCTGGTGAAGGAGAGAGG + Intronic
1073687605 10:105772991-105773013 CTTAAGATTGTGAAAAAGAGAGG + Intergenic
1073834065 10:107420299-107420321 CATGAGTGAGTGAAGGAGAGAGG - Intergenic
1074933344 10:118152260-118152282 CTTGAGATTGTGAAGAAAATTGG - Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075815070 10:125258813-125258835 CTTGACATGTTCAAAGAGAGAGG - Intergenic
1076597931 10:131637459-131637481 CTGGAGATGGCTCAGGAGAGAGG - Intergenic
1077282654 11:1752691-1752713 CTTGGGATGGGGAAGGAGGGTGG - Intronic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1077730109 11:4721441-4721463 CCTGAAGTGGTGGAGGAGAGAGG - Intronic
1077849411 11:6060870-6060892 CTACAGAAGGTGAAGCAGAGGGG + Intergenic
1078563116 11:12390295-12390317 GTGGGGATGGGGAAGGAGAGAGG + Intronic
1078932411 11:15922456-15922478 CTTGGGATGGTGGAGGAGAGGGG - Intergenic
1079106764 11:17576948-17576970 CTCCACATGGTAAAGGAGAGTGG + Intronic
1079777526 11:24551430-24551452 CTTGAGTGGGGGAAGGAGAATGG + Intronic
1080839629 11:35971882-35971904 ATTGGGATGGGGAAGGAGTGGGG + Intronic
1081632515 11:44699533-44699555 GTAGAGATGGTGGAGGAGCGAGG + Intergenic
1081803123 11:45873170-45873192 CTTGAGATGATGACTCAGAGGGG - Intronic
1082043335 11:47705264-47705286 CATGAGATGGGGCAGAAGAGAGG + Intronic
1083235053 11:61345834-61345856 CTGGACAAGGTGAAGGAAAGGGG - Intronic
1083461276 11:62813893-62813915 CTTGAGAAGGTGAAAGGAAGTGG - Intronic
1083583701 11:63840948-63840970 CTAGAGATGGTGAAAGAAAGGGG - Intronic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1086402266 11:86470479-86470501 CTTGAGATGGTCTTAGAGAGAGG + Intronic
1087640265 11:100749072-100749094 CTAGGGAAGGGGAAGGAGAGGGG - Intronic
1088598695 11:111457573-111457595 GTAGAGATGGGGAAGGGGAGAGG - Intronic
1089357908 11:117867332-117867354 GTGGAGATGGGGAAGGAGAGAGG - Intronic
1089412894 11:118262164-118262186 ATTGAGATTGTGAAAGGGAGAGG - Intronic
1089417015 11:118300669-118300691 CTTGAGATGGCCATGGACAGAGG - Intergenic
1089875893 11:121722188-121722210 CTTGAGGTAAAGAAGGAGAGGGG - Intergenic
1090026696 11:123173760-123173782 TTTGATGTGGTGAAGGAGTGCGG - Intronic
1090448947 11:126789274-126789296 CTTGAGAAGGCGAAGGAGATGGG - Intronic
1090764259 11:129863283-129863305 GTAGAGATGGTGGAGGACAGTGG - Intergenic
1090951210 11:131475090-131475112 AATGAGATGGTGGAGGAAAGAGG - Intronic
1091555046 12:1566738-1566760 CTCCAGAAGGTGAGGGAGAGGGG - Exonic
1091688214 12:2578702-2578724 CTTGAGACGGGGAAGGTGATGGG + Intronic
1092076617 12:5678721-5678743 CAGGAGAAGGTGAAAGAGAGTGG - Intronic
1092767378 12:11864894-11864916 TCTGGGATGGTGAAGGAGAGAGG - Intronic
1092940383 12:13402319-13402341 CTGGAGAAGGTGGAAGAGAGAGG - Intergenic
1095381931 12:41605283-41605305 CTTGAAAGGATGAAGGAGAAAGG + Intergenic
1095598044 12:43981155-43981177 CTAGACATGGTGTAGGAGATCGG - Intronic
1096148721 12:49295828-49295850 CTTGGGCTGCTGATGGAGAGGGG - Intronic
1096254764 12:50056298-50056320 CTTAAGATTGTGGAGGAGGGAGG - Intergenic
1096262537 12:50102009-50102031 CTTGAGAAGGGAAAGCAGAGAGG + Intergenic
1096987002 12:55766402-55766424 CTTGAGATGGAAGAGGAGGGAGG - Intronic
1097045074 12:56181510-56181532 CTGGGGTTGGTGAAGGAGAGGGG + Exonic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1099989504 12:89708386-89708408 CGGGAGATTGTGAAGGTGAGCGG - Intronic
1100049031 12:90421870-90421892 CTTCAGATAGGGAAGCAGAGAGG + Intergenic
1100268769 12:93003624-93003646 CTAGAGAAGGTGCAGGGGAGGGG + Intergenic
1100702748 12:97165183-97165205 ATTGACAAGGTGGAGGAGAGGGG + Intergenic
1101439094 12:104689796-104689818 ATTGGGAGGGGGAAGGAGAGAGG - Intronic
1101666913 12:106825491-106825513 CTTAAGAAGGTAAATGAGAGTGG + Intronic
1101751335 12:107584980-107585002 CTTTGGAAGGTGAAGGAGTGGGG + Intronic
1102146113 12:110656234-110656256 GTGAAGATGGTGAAGGGGAGAGG + Intronic
1103472990 12:121196850-121196872 CTTGGGATGGACAAGGGGAGGGG - Intergenic
1103504498 12:121432800-121432822 CCTGAGCTGGTGATGGAGTGGGG - Intronic
1103887055 12:124210398-124210420 CTTAAGATGGAGAAGAGGAGAGG - Intronic
1103909786 12:124345861-124345883 CTTGTGAAGGGGAAGGAGAATGG - Intronic
1104632685 12:130417569-130417591 CACTAGATGGTGAAGGAGGGAGG + Intronic
1104715799 12:131015432-131015454 ATAGAGATGGAGATGGAGAGGGG + Intronic
1104715827 12:131015576-131015598 ATGGAGATGGAGATGGAGAGGGG + Intronic
1105024604 12:132839673-132839695 CTTGAGTTGGTGCAGGGGTGAGG - Intronic
1105660003 13:22483819-22483841 CTTGAGCTGGTGAATGAGCTAGG - Intergenic
1106398896 13:29408559-29408581 CTTTGGATGGTCAAGGAGGGAGG - Intronic
1106765635 13:32911009-32911031 CTTGAGTTGGTGAGTGAGAAGGG - Intergenic
1108297938 13:49043829-49043851 TTTGAGTTGCTGAAGGAGAGGGG - Intronic
1111719791 13:91928194-91928216 ATTAGGATGGGGAAGGAGAGTGG - Intronic
1111966127 13:94863945-94863967 CTTGAGATGGTAAAGGGAATCGG + Intergenic
1113171407 13:107508150-107508172 CTTGAGATGGTAAATGTTAGAGG + Intronic
1116071318 14:40049121-40049143 CTTGAGATAGAGAGGGAAAGGGG - Intergenic
1116622445 14:47223436-47223458 CTTAAGATTGTTTAGGAGAGAGG + Intronic
1117070142 14:52048818-52048840 CTGGAGGTGTTGAAGGAGTGAGG + Intronic
1118065381 14:62185076-62185098 CTGGAGATAGTCAAGGAGAGTGG + Intergenic
1118330192 14:64808904-64808926 CTTTGGATTGTGAAGGGGAGGGG + Intronic
1118342527 14:64906855-64906877 CGGGAGATGGAGAAGGAGAAAGG - Intergenic
1118457474 14:65958007-65958029 CCTGAGCTGGGGCAGGAGAGGGG - Intronic
1119830680 14:77699609-77699631 CTTGTGATGGGCCAGGAGAGAGG - Intronic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1123493764 15:20802290-20802312 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1123550263 15:21371355-21371377 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1125953948 15:43776683-43776705 CTGGAGAAGGTGCAGGGGAGAGG - Intronic
1126622733 15:50656250-50656272 CTGGAGATGGTTAAGTACAGGGG + Intronic
1126893121 15:53227666-53227688 CTATAGAGAGTGAAGGAGAGAGG + Intergenic
1127385516 15:58463427-58463449 CTTGAGAGGGTGGAGAGGAGTGG - Intronic
1128633965 15:69291168-69291190 CCTGAGATTGGGGAGGAGAGAGG - Intergenic
1128771323 15:70284600-70284622 CTTGAGTTTGTGAATGAAAGAGG - Intergenic
1128804247 15:70518786-70518808 GTTGAGATGATGAAAGAGAATGG - Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1130673245 15:85930966-85930988 CAACAGAGGGTGAAGGAGAGGGG - Intergenic
1130726660 15:86445987-86446009 CTTGAGATGGAGAGAGAGGGAGG + Intronic
1202958604 15_KI270727v1_random:98610-98632 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1132926577 16:2432842-2432864 CTTGGGATGGCGAGGGAGACAGG + Intronic
1133577698 16:7109708-7109730 CTTGAGGTGGAAAAGAAGAGGGG + Intronic
1135803121 16:25517681-25517703 CTTGAAATGGTGATGGAAGGTGG - Intergenic
1136265452 16:29114940-29114962 CTTGAGATCAGAAAGGAGAGTGG + Intergenic
1136376016 16:29865362-29865384 CAGGAGATGGTGGAAGAGAGGGG - Intergenic
1137507545 16:49067459-49067481 CTGGGGATGGGGCAGGAGAGTGG + Intergenic
1137514682 16:49132900-49132922 TGTGAGATGGGGCAGGAGAGAGG + Intergenic
1139852244 16:69958423-69958445 GTTGAGAGGGGGATGGAGAGGGG - Intronic
1139881215 16:70181327-70181349 GTTGAGAGGGGGATGGAGAGGGG - Intronic
1140371291 16:74414191-74414213 GTTGAGAGGGGGATGGAGAGGGG + Intronic
1140937865 16:79691458-79691480 CTTGGGATGGAGTGGGAGAGAGG + Intergenic
1141123867 16:81386076-81386098 CTAGAGATGTAGATGGAGAGAGG - Exonic
1141229362 16:82150351-82150373 CTTCAGATTGAGAAGGAGAGGGG - Intronic
1142054259 16:87982874-87982896 CTTGAGATCAGAAAGGAGAGTGG + Intronic
1142851492 17:2706948-2706970 CCTGGGCTGGGGAAGGAGAGTGG - Intronic
1143204753 17:5133881-5133903 CTACAGATCATGAAGGAGAGGGG + Exonic
1143376165 17:6468923-6468945 CTGGAGTGGGTGGAGGAGAGGGG - Intronic
1143747293 17:9003646-9003668 CTGGAGATGGGGAAAGCGAGGGG - Intergenic
1143923613 17:10350286-10350308 ATTTAGATGGTGAAAGATAGTGG + Intronic
1144201244 17:12944266-12944288 GTGGAGATGGTACAGGAGAGAGG - Intronic
1145018007 17:19411476-19411498 CCTAAGATCGGGAAGGAGAGTGG + Intronic
1146085227 17:29822162-29822184 CTGGAGATGCTGAAGGGGATGGG - Intronic
1146706020 17:35001381-35001403 CTTGAGTTGGGGAAGGTTAGTGG - Exonic
1147122514 17:38343903-38343925 CGTGAGAGGGAGACGGAGAGAGG - Intergenic
1147556952 17:41485726-41485748 CTGGGGATGGTTAAGGAGAGGGG - Intergenic
1147845201 17:43399836-43399858 CTTGAGGCGGTAAAGGAGGGAGG - Exonic
1147921442 17:43919536-43919558 CTAGAGATGGTGAAGGTTGGGGG - Intergenic
1148546430 17:48522566-48522588 CTGGAGAGGATGAAGGAAAGGGG + Intergenic
1148860530 17:50602163-50602185 CTGGAGATGGAGAAGCTGAGTGG - Intronic
1148984953 17:51613291-51613313 CGGGAGAAGGGGAAGGAGAGAGG - Intergenic
1149431604 17:56598486-56598508 GTTGAGATGGAGAAGGCCAGGGG + Intergenic
1149512387 17:57254854-57254876 ATTGATGTGGTGAAGGTGAGAGG - Intergenic
1149771944 17:59329578-59329600 TTTGAGCTGGTAAAGGAGAAGGG - Intergenic
1150497271 17:65617536-65617558 CCTGAGTTGGTGAATGAGAAAGG + Intronic
1154142729 18:11839443-11839465 CTTGATATGGTGAAAGCGGGAGG + Intronic
1154451292 18:14476745-14476767 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1155049793 18:22136724-22136746 CATGAGGTGGTGAAGGAGATTGG + Intergenic
1156245518 18:35294013-35294035 TATAAAATGGTGAAGGAGAGGGG + Intergenic
1157002841 18:43547582-43547604 CTAAAGATGGTGAAAGAAAGTGG - Intergenic
1157959667 18:52138535-52138557 GTTGAGCTGAAGAAGGAGAGTGG + Intergenic
1160228950 18:77032109-77032131 CTTGAGAGGGGCCAGGAGAGTGG - Intronic
1160278899 18:77468309-77468331 CTTGTGATGGAAAAGCAGAGTGG + Intergenic
1160288813 18:77571726-77571748 CTTGAGATGGGGAAGGTGAGTGG + Intergenic
1161692337 19:5743488-5743510 CTTGAGATGGGGAGGCAGGGAGG + Intronic
1161836079 19:6647555-6647577 CTTTGGGAGGTGAAGGAGAGCGG + Intergenic
1161915663 19:7225995-7226017 TTTGATGTGGTGGAGGAGAGGGG - Intronic
1162134323 19:8545803-8545825 GATGAGATGGAGAAGGGGAGAGG - Intronic
1162864928 19:13538446-13538468 GTTGAGATGGTAAAGCAGACAGG + Intronic
1163020019 19:14476901-14476923 CTTGCGGTGGTGAAGGGGTGTGG - Intergenic
1163021230 19:14481988-14482010 CATGAGATGGTGGAGGCTAGAGG - Intronic
1163131273 19:15274806-15274828 GGTGAGAAGGTGAAGAAGAGTGG - Intronic
1163452996 19:17390329-17390351 CTTTACATGGTGGGGGAGAGAGG + Intergenic
1164032508 19:21420123-21420145 CCTGTGTTGGTGAAGGAGACAGG - Intronic
1164728612 19:30483969-30483991 ATTGGGATGGTGAGGTAGAGGGG - Intronic
1165119353 19:33549190-33549212 CCTGGGATGGTGGGGGAGAGGGG - Intergenic
1165848804 19:38836992-38837014 CTTGGGCTGGCGAAGGAGATAGG - Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168374405 19:55863684-55863706 GTTAAGATAGTGAAGGAGAGGGG + Intronic
925328246 2:3039283-3039305 CATGAGATCGTGAAAGACAGTGG + Intergenic
926229237 2:10990322-10990344 ACTGACACGGTGAAGGAGAGAGG + Intergenic
928947574 2:36785538-36785560 CTTGAGATGAAGAATGAAAGAGG - Intronic
929529759 2:42741593-42741615 ATAGAGATGCTCAAGGAGAGGGG + Intronic
929557795 2:42936476-42936498 GATGACATGGTGAGGGAGAGGGG + Intergenic
930584202 2:53250394-53250416 GTGGAGATGGTGTAGGGGAGTGG + Intergenic
930608231 2:53514363-53514385 GTTGAGATTAGGAAGGAGAGGGG - Intergenic
930848087 2:55926964-55926986 ACTGAGATGGTGAAGGTGGGTGG - Intergenic
930889135 2:56362531-56362553 TTAAAGATGGAGAAGGAGAGAGG + Intronic
931186043 2:59952312-59952334 CGTGAAATGGTGACAGAGAGGGG - Intergenic
931195685 2:60050504-60050526 CTTGGGATGGGGAAGGGGACTGG + Intergenic
931606100 2:64053618-64053640 CTTGGCATGGGGAAAGAGAGAGG + Intergenic
931774106 2:65525036-65525058 CCTGAGATGGTAAGAGAGAGGGG + Intergenic
934296777 2:91748892-91748914 CTGGAGATGGTGGAGCGGAGGGG - Intergenic
934662810 2:96152334-96152356 CATGAGATGGAGCAGGGGAGAGG + Intergenic
935191465 2:100781920-100781942 CTGGGGAGGGAGAAGGAGAGAGG - Intergenic
936637360 2:114273863-114273885 CTTGGAATGGTGAAGGTCAGAGG + Intergenic
937107426 2:119330663-119330685 TTGGAGATAGTGAAGGAGAGAGG - Intronic
937117834 2:119421447-119421469 CTTGAGATGGTGCAGGGAAGTGG + Intergenic
938776941 2:134550377-134550399 CTTGGGATGGTCAGAGAGAGAGG - Intronic
939815571 2:146892552-146892574 CATGAGATTCTGAATGAGAGAGG + Intergenic
941417013 2:165233426-165233448 ACTGAGATGCTGAAGTAGAGAGG - Intergenic
941547748 2:166874596-166874618 ATTTAGATTGTGATGGAGAGTGG - Intergenic
941591204 2:167422621-167422643 CTGGAGATTGGGAGGGAGAGTGG + Intergenic
944089869 2:195894496-195894518 TTTGAAATGCTGAAGGAGTGGGG - Intronic
944194873 2:197041767-197041789 GGTAAGATGGAGAAGGAGAGAGG - Intronic
944572603 2:201059636-201059658 CTTAAGAGGGAGAAGGGGAGAGG - Intronic
945448211 2:209963286-209963308 ATTGAGAGGGTGAGGGAGAGAGG - Intronic
945578244 2:211559095-211559117 CCTGAGGTGGTGAAGGATGGGGG - Intronic
945758176 2:213876667-213876689 CTTGAGAAGGGGAAGGATGGAGG - Intronic
947350302 2:229236500-229236522 CCTGAAATGGTAAAGGAGAAAGG + Intronic
947361580 2:229350719-229350741 GTTGAGATGGGGAAGGGGAGTGG - Intergenic
947434437 2:230060788-230060810 CTGGAGATGGTGAAACAGATTGG + Intronic
947761059 2:232604283-232604305 CATGAGATGGAGGAGCAGAGAGG - Intergenic
948040475 2:234897493-234897515 AATGAGATAGAGAAGGAGAGGGG + Intergenic
1169022667 20:2341108-2341130 CCTAAGGTGGTGAAGGAGAGAGG + Intergenic
1169163812 20:3406467-3406489 TTTGAGAAGGAGAGGGAGAGGGG - Intronic
1169543919 20:6631238-6631260 ATTGGTATGATGAAGGAGAGTGG - Intergenic
1170546133 20:17437051-17437073 CCTGTGATGGATAAGGAGAGAGG + Intronic
1173187938 20:40855605-40855627 CTTGAGACTGTGGAGGGGAGAGG - Intergenic
1174838318 20:53878538-53878560 GTTGAGATGGTGAAGGGAAGAGG + Intergenic
1176444851 21:6813484-6813506 CTTAAGATTGTGAGGGAGTGTGG + Intergenic
1176823017 21:13678517-13678539 CTTAAGATTGTGAGGGAGTGTGG + Intergenic
1176942819 21:14944471-14944493 CCAGAGATGGAGAAGGAGACTGG + Intergenic
1177162832 21:17567066-17567088 CTTAAGATTGTGAGGGAGTGTGG + Exonic
1177951512 21:27543825-27543847 CTTGAGAGGGTAAAGGGGATGGG + Intergenic
1179658751 21:42861520-42861542 CGAGAGATGGTGAAGGGGAGGGG + Intronic
1181321365 22:22009255-22009277 CTTGAGATAGTGTGGGAGAGAGG + Intergenic
1181338465 22:22159554-22159576 TTTGAGATGGGGAAGCAGAGAGG - Intergenic
1182357120 22:29727253-29727275 ATGGAGATGGTGGGGGAGAGGGG + Intronic
1183309121 22:37099850-37099872 TATGAGATGGGGAAGGGGAGAGG + Intronic
1184437831 22:44490334-44490356 CTGGAGCAGGTGCAGGAGAGAGG + Intergenic
1185032254 22:48450281-48450303 CTGGAGCTGGGGAAGCAGAGAGG + Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950199724 3:11034508-11034530 CTGGAGAGGGTGGAGGGGAGGGG - Intronic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
951899711 3:27645060-27645082 CTCTAGATGGACAAGGAGAGGGG - Intergenic
952218603 3:31302129-31302151 AGGGAGAAGGTGAAGGAGAGAGG - Intergenic
952419049 3:33114700-33114722 GTTGAGATGAAGAAGGAGACAGG - Intronic
952836190 3:37604207-37604229 CTTTAAATGGAGAAGGAGTGGGG + Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953165973 3:40465247-40465269 CTTGAGATCGTCAAAGTGAGGGG + Intergenic
953721075 3:45355624-45355646 TTTGTGATGGAAAAGGAGAGAGG - Intergenic
953792898 3:45962075-45962097 AGTGAGATGGAGAAGGAGAGAGG + Intronic
953843962 3:46412251-46412273 CTGGAGATGTTGGAGGGGAGAGG + Intronic
954886922 3:53882715-53882737 ACTGAGATGGTGAAAGTGAGAGG - Intergenic
957791264 3:84943949-84943971 GTTAAGATAGTAAAGGAGAGAGG - Intergenic
959009998 3:101064049-101064071 CTGGAGATTGTGAAGGACTGGGG - Intergenic
959661648 3:108875184-108875206 CTTGACATGGAGAAAGAGAAAGG + Intergenic
959919487 3:111855188-111855210 CCTGAGAGGGTGAAGGACACAGG + Intronic
960063861 3:113350101-113350123 CATGAAAAGGGGAAGGAGAGGGG + Intronic
960252466 3:115471083-115471105 CTGGAAAGGGTGAATGAGAGTGG - Intergenic
960691711 3:120352870-120352892 CTGGAGAAGGTAAAGGACAGAGG + Intergenic
960811861 3:121633781-121633803 CTTGAGGTGGCCAAGGTGAGAGG - Intronic
961079480 3:124013789-124013811 CTTGGCATGGTGAGGGAGTGAGG + Intergenic
961813700 3:129536636-129536658 CCTGAGATGATGAGGGAGGGAGG - Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
962270796 3:133976736-133976758 TTTGAGATGTTGAAGGGCAGGGG - Intronic
962906043 3:139803968-139803990 CTAGAGATGGTGGGGGAGATTGG - Intergenic
963131075 3:141858395-141858417 CCTGGGATGGTGATGGAGCGAGG - Intergenic
963534646 3:146512721-146512743 CTAGAGACAGTAAAGGAGAGAGG + Intergenic
963781546 3:149491729-149491751 TGTGAGATGGAGAAGGAGTGCGG + Intronic
963824181 3:149933162-149933184 CTTAAGATGGTGCAGGGCAGAGG + Intronic
964914313 3:161820956-161820978 GTTGAGAATGTGAAGGTGAGAGG + Intergenic
966311770 3:178602046-178602068 CTTGACATGATAGAGGAGAGAGG + Intronic
966427400 3:179794128-179794150 CTTGAGATATTCAAGGAGTGGGG + Intergenic
966549946 3:181193777-181193799 GTTGAGGTGGTGACAGAGAGAGG + Intergenic
969613567 4:8240009-8240031 CTTGAGATGGTAAAGGGGAATGG + Intronic
971351571 4:25860843-25860865 AGTGAGATAGTGAAGGAGTGAGG - Intronic
971522007 4:27565438-27565460 CTTGAGTAGGTGAGGGAGAATGG - Intergenic
973800200 4:54470281-54470303 GGTGGGAGGGTGAAGGAGAGGGG + Intergenic
974393316 4:61302239-61302261 GTTAAAATGATGAAGGAGAGAGG + Intronic
974394186 4:61313962-61313984 TTTGGGATGTTGAAGGAAAGTGG + Intronic
975497398 4:75049671-75049693 CCTCAGATGGTAAAGGACAGAGG - Exonic
975869899 4:78768493-78768515 CTTGAGATGCAGAAGGACAGCGG + Intergenic
977064847 4:92302552-92302574 CTTGAGATGGTGAAGGAGAGTGG + Intronic
977324030 4:95552382-95552404 CTTGAGAGGCTGAAGAGGAGAGG - Intergenic
978155006 4:105479639-105479661 GTGGGGATGGTGAAGGAGACAGG - Intergenic
979472955 4:121123002-121123024 GGTGAGATGGTGAAACAGAGAGG + Intergenic
979601531 4:122591182-122591204 CCTGAGATAGTGTAGGAGTGTGG + Intergenic
980022135 4:127722782-127722804 CTGGAAGTGGGGAAGGAGAGGGG - Exonic
980383258 4:132054830-132054852 CATGAGTTTGAGAAGGAGAGAGG + Intergenic
980775944 4:137436668-137436690 CCTGTGAAGGTTAAGGAGAGAGG - Intergenic
981848686 4:149201457-149201479 CCTGAAATAGTGATGGAGAGGGG - Intergenic
982224195 4:153151344-153151366 CTTGAGAAGGTCAAGGTGGGCGG + Intergenic
983122404 4:163902996-163903018 CTGGAGAGTGTGAAGGAAAGAGG - Intronic
983751448 4:171277720-171277742 TTTGAGATTGTGAGGGAGATCGG - Intergenic
985160554 4:187040069-187040091 TATTAGATGGTGAAGTAGAGAGG + Intergenic
985675589 5:1229854-1229876 CTGGAGATGGGGGAGGGGAGAGG + Intronic
985955874 5:3266026-3266048 CTTGCAAGGGTGAAGGAGTGAGG + Intergenic
986185575 5:5433347-5433369 TTTGAGAAGGTGAAGGGGAATGG - Intronic
987973551 5:24981449-24981471 CTTTAGAAGGCCAAGGAGAGGGG - Intergenic
989085286 5:37669731-37669753 CATGCGTTTGTGAAGGAGAGAGG + Intronic
991512191 5:67391719-67391741 CTAGTGATTGTGAAGGAGAGTGG + Intergenic
992084022 5:73261731-73261753 GGAGAGTTGGTGAAGGAGAGTGG - Intergenic
992977839 5:82138876-82138898 CATGAGAGGGAGAGGGAGAGGGG - Intronic
994165218 5:96601097-96601119 AAGGAGATGTTGAAGGAGAGAGG - Intronic
995067742 5:107880948-107880970 GTGGAGATAGAGAAGGAGAGAGG + Intronic
995178067 5:109201439-109201461 CTAGAGATGGGGAAGGGGTGAGG + Intergenic
996203158 5:120700472-120700494 CTTTAGATTGTGAAGAAGGGTGG + Intergenic
996562209 5:124843092-124843114 CTGGAGGTGGTTAAGGAGCGAGG + Intergenic
996765609 5:127031468-127031490 CTTGCGAAGGGGAAGGAGGGCGG - Intergenic
996970035 5:129356034-129356056 CTTGAGATGAAGAAGCAGAAAGG - Intergenic
997022412 5:130016878-130016900 TTTGAGATAGTAGAGGAGAGTGG + Intronic
997615762 5:135245173-135245195 ATTGAGAAGGTGAGGGCGAGAGG - Intronic
998655243 5:144171151-144171173 CTGGAGTTGGTGGTGGAGAGGGG + Intronic
998934705 5:147222460-147222482 CCTGAGAAGGAGAAGGAAAGTGG - Intergenic
999127312 5:149255200-149255222 CTTGTGATGGTGGAAGAGAGTGG - Intronic
1000787793 5:165567950-165567972 ATTGAGAAGGTGAAGCACAGGGG - Intergenic
1001897515 5:175394208-175394230 CTTGAGGTGGTGGAGGAGAGAGG + Intergenic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1003358305 6:5396811-5396833 CTTGAAGAGGTGAAGGTGAGGGG - Intronic
1003512393 6:6792325-6792347 GTTGAGATGGTAAAGGTGAATGG - Intergenic
1004603907 6:17176181-17176203 CTGAAGATGGTCAAGGAGAGGGG + Intergenic
1004625670 6:17374301-17374323 CTTAAGAAGGTCAAGGTGAGTGG + Intergenic
1005071190 6:21863476-21863498 CTTGAGGGGGTGAAGGCGGGGGG + Intergenic
1005261346 6:24064146-24064168 CTTAAACTGGTGCAGGAGAGTGG + Intergenic
1005519264 6:26584341-26584363 ATTGACATGGTGAAGGTCAGGGG + Intergenic
1006278711 6:33029022-33029044 GGAGAGATGGAGAAGGAGAGAGG - Intergenic
1007318407 6:41008601-41008623 CTTGAGGTGGTGGGGGTGAGGGG - Intergenic
1010185379 6:73138014-73138036 CTTGAGATGATGTAGTTGAGAGG - Intronic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1014204645 6:118644599-118644621 CCTGAGATGGGGAAGGTTAGTGG - Intronic
1015579042 6:134703510-134703532 CCAGAGATGGTTAAGGTGAGTGG + Intergenic
1017702676 6:157090872-157090894 CTGGAGAGGGAGAAGGGGAGGGG - Intronic
1017846335 6:158261781-158261803 CTAAAGATGGTGAAAGAGAAAGG - Intronic
1018227983 6:161648149-161648171 CTTGAGATGCCCAAGGACAGTGG + Intronic
1018377873 6:163230967-163230989 ATTGAGATGGCAGAGGAGAGAGG + Intronic
1018596538 6:165487115-165487137 CTTGAGATGGCAAATGACAGTGG + Intronic
1019635178 7:2071623-2071645 CCTAAGCTGGGGAAGGAGAGGGG + Intronic
1019663227 7:2237482-2237504 CTTGAGATGAAGCAGGAGAGTGG - Intronic
1021783276 7:24127690-24127712 TGTGAGAAGGTGAAGGAGGGAGG - Intergenic
1022122838 7:27326292-27326314 CATGAGATTTTGATGGAGAGAGG - Intergenic
1022633754 7:32111448-32111470 CATGAGATGGTGCAGGAAACAGG + Intronic
1023137229 7:37064738-37064760 CTGCAGATGGGGAAGGAGATAGG - Intronic
1024141094 7:46464095-46464117 CTAGAGATGGAGAAAGTGAGGGG + Intergenic
1024715919 7:52078919-52078941 CTTGGGATGGTGATGGCGTGTGG - Intergenic
1024760712 7:52593703-52593725 CTTGAGGTGAGCAAGGAGAGCGG - Intergenic
1025018945 7:55465575-55465597 CTTGAGAAGTTGAAGCACAGTGG - Intronic
1025777216 7:64569995-64570017 CCTGTGATGGTGAATGAGGGAGG - Intergenic
1025959420 7:66206652-66206674 CTGCAGATGGGGATGGAGAGGGG - Intronic
1026212730 7:68321204-68321226 CTGGAGGTGGTGAGGGAGAATGG - Intergenic
1027253454 7:76414337-76414359 CTTGAGGTGGTGACTTAGAGAGG - Intronic
1028170033 7:87585068-87585090 TGAGAGATGGAGAAGGAGAGTGG - Intronic
1028767828 7:94580303-94580325 CATGAGATGGTGAAGTATAGGGG - Intergenic
1029195726 7:98804022-98804044 CTGGAGTTGGGGAAGGAGCGAGG + Intergenic
1029852166 7:103473988-103474010 CTTGAGTTAGGGTAGGAGAGGGG + Intronic
1030198956 7:106882451-106882473 TTAGAGATGGAGAAGGAAAGAGG - Intronic
1030567168 7:111172650-111172672 CTTGAGGAGGGGAAGGAAAGGGG - Intronic
1030597415 7:111556652-111556674 GTAAAGATGCTGAAGGAGAGTGG - Intronic
1030872587 7:114775230-114775252 CTAAAGATGGTGAAGCAGAAAGG + Intergenic
1031165646 7:118224430-118224452 CTTGTGATGGGGATGGGGAGGGG - Intronic
1031905623 7:127457416-127457438 CTTGAGGTGGAGAAGGGGTGGGG - Intergenic
1032846276 7:135754456-135754478 CAGGAGATGGGGTAGGAGAGAGG + Intergenic
1033182224 7:139191782-139191804 CATGTGATGATGGAGGAGAGAGG + Exonic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033756543 7:144401474-144401496 CCTGAGATGGTGCAGGAGGGTGG + Exonic
1033843491 7:145403629-145403651 CCTGGGATGGTGCAGGACAGTGG - Intergenic
1034220245 7:149438837-149438859 GTTGAGTTGGTGAATCAGAGAGG - Intronic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1035486266 7:159228638-159228660 CTTGAAATCATGGAGGAGAGGGG + Intergenic
1035774025 8:2173624-2173646 CTAAAGATGGAGGAGGAGAGGGG + Intergenic
1035901836 8:3465317-3465339 CTTGAGGGGATGGAGGAGAGAGG + Intronic
1036160344 8:6381758-6381780 CTTGAGATTGTGGAGGAAGGTGG - Intergenic
1036585201 8:10117255-10117277 CATGGGATGGGGGAGGAGAGAGG + Intronic
1036835641 8:12063328-12063350 CTTAAGATGGCAAAGAAGAGAGG + Intergenic
1036857484 8:12309901-12309923 CTTAAGATGGCAAAGAAGAGAGG + Intergenic
1037626206 8:20609263-20609285 TTTGAGAAGGTGAAGGAAAATGG + Intergenic
1039068080 8:33626810-33626832 ACAGTGATGGTGAAGGAGAGGGG - Intergenic
1039506349 8:38055162-38055184 CGTGAGATGCTGAAGGGCAGAGG - Intronic
1039792104 8:40884257-40884279 CTTGAGTGGGTGAGGGAGTGAGG - Intronic
1040486583 8:47878487-47878509 CCTGGCATGGTGAAGGAGGGGGG - Intronic
1040510272 8:48087217-48087239 CTGGAGCTGCTGCAGGAGAGGGG + Intergenic
1040703747 8:50100257-50100279 CTAGAGGTTGTGAAGGACAGAGG + Intronic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1045545729 8:103126598-103126620 CTTGAGAAGATGAAGGGGACGGG - Intergenic
1045642163 8:104262615-104262637 CTTGAAAGGGTCAAGGAGAGGGG + Intergenic
1045658704 8:104413430-104413452 GTTGAGATGAGGAAGGAGACAGG + Intronic
1045757155 8:105557072-105557094 ATTGAGAATTTGAAGGAGAGGGG - Intronic
1047317434 8:123747549-123747571 GGTCAGAGGGTGAAGGAGAGTGG + Intergenic
1047825523 8:128569844-128569866 ATTGAGATGGTGTGGTAGAGGGG + Intergenic
1048283358 8:133121833-133121855 TATGTGATGGTGATGGAGAGAGG - Intronic
1048315228 8:133356694-133356716 GTAGAGATGGTGACGCAGAGGGG + Intergenic
1048601969 8:135928253-135928275 TTTGAGGAGTTGAAGGAGAGGGG + Intergenic
1050002533 9:1093380-1093402 CTTGAGGTGGTTAATGAGATAGG + Intergenic
1050308600 9:4330555-4330577 GTTGAGATGGAGATGAAGAGAGG + Intronic
1050308619 9:4330655-4330677 GTTGAGATGGAGATGAAGAGAGG + Intronic
1050308623 9:4330689-4330711 GTTGAGATGGAGATGAAGAGAGG + Intronic
1052790829 9:32874137-32874159 CTGGGGAGGGGGAAGGAGAGTGG - Intergenic
1055045168 9:71916590-71916612 CTTGAGATGGAGATGGAAAATGG + Intronic
1056188560 9:84162211-84162233 CTTGAGATTGTGAATGAAAATGG + Intergenic
1056674322 9:88661006-88661028 CTTGAGATGTTGAAATACAGAGG + Intergenic
1056690084 9:88800559-88800581 CTTGAGATGGGGGAGGCCAGAGG + Intergenic
1056834775 9:89945475-89945497 CTTCTGATGGTGAAGATGAGGGG - Intergenic
1057719907 9:97523674-97523696 AATGAGATGGTGTAGGTGAGGGG + Intronic
1058139555 9:101342626-101342648 CAGGAGAGGGGGAAGGAGAGAGG + Intergenic
1058152944 9:101481916-101481938 CTTGACAAGGGGAAGGCGAGGGG - Intronic
1058888027 9:109337627-109337649 CTTGAGATGCTCAGGGAAAGAGG - Intergenic
1059329350 9:113525108-113525130 CTTGGGTTGGTGTGGGAGAGGGG + Intronic
1059440743 9:114305469-114305491 CTTAACATGATGAAGGAAAGTGG + Intronic
1060144012 9:121235476-121235498 CTTGAGCTGGACAGGGAGAGAGG - Intronic
1060265938 9:122111461-122111483 GTTGTGATGGGGAAGCAGAGAGG - Intergenic
1060464535 9:123891206-123891228 CTTGGGACCATGAAGGAGAGAGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061215512 9:129219433-129219455 CTGGAGATGGCGGCGGAGAGAGG + Intergenic
1061545874 9:131304012-131304034 CCTGAGATGGGGAAGCACAGGGG + Intronic
1203524346 Un_GL000213v1:71042-71064 CTTAAGATTGTGAGGGAGTGTGG - Intergenic
1185511504 X:667957-667979 TGTGAGGGGGTGAAGGAGAGGGG - Intergenic
1186305456 X:8251680-8251702 TTTGAGATGATGGAGGAGAACGG - Intergenic
1186729268 X:12391217-12391239 ATTGAAATGGGGAAGGGGAGAGG + Intronic
1187002281 X:15194620-15194642 CTTGAGAAGATGTTGGAGAGAGG - Intergenic
1187303534 X:18074411-18074433 CATGAGATGGGCAAGGAGAATGG + Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187877196 X:23814294-23814316 CTTGAGGAGGGGAAGGGGAGAGG - Intergenic
1190712823 X:53082058-53082080 GCTGAGAGGGTGAGGGAGAGGGG + Intergenic
1194937577 X:99970112-99970134 CTTGAGTTGGTGAAGGCCACGGG - Intergenic
1195014134 X:100761870-100761892 CTTGAGAGGCTTAAGGAGATTGG - Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1195988934 X:110663547-110663569 CATCAGATAGTAAAGGAGAGTGG - Intergenic
1196556432 X:117090280-117090302 CTTGAGAGAGAGAAAGAGAGTGG - Intergenic
1197313973 X:124941082-124941104 GATGGGATGGTCAAGGAGAGAGG - Intronic
1197651878 X:129073991-129074013 TTTGAGATTGGGAAGAAGAGGGG + Intergenic
1197872746 X:131074782-131074804 CTAGAGATGGTGGAGGGAAGGGG - Intronic
1200219280 X:154383221-154383243 CTTGGGATGGTGAGGGGCAGAGG - Intergenic
1200835206 Y:7725829-7725851 CATGCGATGGTGAAGGTGAAAGG - Intergenic
1202300186 Y:23405168-23405190 AATGAGAAAGTGAAGGAGAGAGG + Intergenic
1202570624 Y:26265430-26265452 AATGAGAAAGTGAAGGAGAGAGG - Intergenic