ID: 977065074

View in Genome Browser
Species Human (GRCh38)
Location 4:92304302-92304324
Sequence CATCGCTGCGCGGGGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977065074_977065091 29 Left 977065074 4:92304302-92304324 CCCGCGGCCCCCGCGCAGCGATG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 977065091 4:92304354-92304376 TGCCCAAGAGCAGTAGAGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 229
977065074_977065088 25 Left 977065074 4:92304302-92304324 CCCGCGGCCCCCGCGCAGCGATG 0: 1
1: 0
2: 0
3: 6
4: 127
Right 977065088 4:92304350-92304372 CCCCTGCCCAAGAGCAGTAGAGG 0: 1
1: 0
2: 0
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977065074 Original CRISPR CATCGCTGCGCGGGGGCCGC GGG (reversed) Intergenic
900537366 1:3185528-3185550 CATCCCTGCACTTGGGCCGCAGG - Intronic
901185501 1:7370131-7370153 CAGCTCTCCGCGGGGGCAGCAGG + Intronic
902338022 1:15765031-15765053 CATCGCGGCGCGGGGGTGCCAGG - Exonic
911208733 1:95117904-95117926 CCGGGCGGCGCGGGGGCCGCGGG - Exonic
914753183 1:150549415-150549437 CCTCGCTCCGCGGCGGCCACTGG - Exonic
921923217 1:220690727-220690749 CACCACTGCCCGGGGGGCGCGGG + Intronic
1064645179 10:17453606-17453628 CAGCGCTGCGGGGGTGCCGTGGG + Exonic
1073105708 10:101031151-101031173 CCACGCTGCGCGGAGGCTGCGGG + Intronic
1073299311 10:102461333-102461355 AATCGCTGGGCGGGGGCGGAGGG + Intergenic
1076577109 10:131476542-131476564 CCTGGCTGCCAGGGGGCCGCAGG - Intergenic
1077194351 11:1271998-1272020 CAGCCCTGCGCGGTGGCCCCAGG - Intergenic
1077329959 11:1979818-1979840 CATGGCTGGGAGGGGGCCACGGG + Intronic
1079361957 11:19777129-19777151 CCTCGCAGCGCGGAGGCCGCTGG - Intronic
1080551265 11:33375944-33375966 CTCCGCTGCGCGGGAGCCGCCGG + Intergenic
1083316422 11:61817174-61817196 CAGGGCTGCGGGGTGGCCGCAGG + Intronic
1086043026 11:82501265-82501287 CCTCACTGCCCGGGGCCCGCAGG - Intergenic
1089700212 11:120240102-120240124 CGGCGCGGGGCGGGGGCCGCCGG - Intronic
1090977174 11:131688176-131688198 CCTCGCGGCTCGGGGGGCGCGGG - Intronic
1202812936 11_KI270721v1_random:34997-35019 CATGGCTGGGAGGGGGCCACGGG + Intergenic
1091980119 12:4857998-4858020 CAGCGATGTGCGGGGGCCTCGGG - Intergenic
1092163512 12:6329005-6329027 CAAGGCTGCTCGGGGGCCCCTGG - Exonic
1094282756 12:28758146-28758168 CATTGCTGAGGGGGGGCCTCAGG - Intergenic
1096634311 12:52948954-52948976 CAGGGCTGCGCGGAGGGCGCGGG + Exonic
1103623760 12:122204069-122204091 CAGCGCTGCGCGTCGGGCGCGGG - Intronic
1107426291 13:40296330-40296352 CACCTCTGGGTGGGGGCCGCAGG + Intergenic
1117547841 14:56808043-56808065 TAAGGCTGCGCGGGGGGCGCGGG - Intronic
1118854700 14:69611838-69611860 CACCGCGGCCCGGGGGCGGCGGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119756716 14:77125028-77125050 GTTGGCTGCGCGGGGACCGCGGG - Intronic
1123033209 14:105460815-105460837 CATCTCGGCGCTGGTGCCGCAGG + Exonic
1128479295 15:68023412-68023434 CACCTCTGGGTGGGGGCCGCAGG + Intergenic
1128501460 15:68229846-68229868 CCTCGCGGGGCGGGGGCTGCTGG + Intronic
1131060149 15:89399699-89399721 CCTCGCTGCGCGGGGCAGGCCGG - Intergenic
1132255619 15:100373627-100373649 CAGGGCTGGGCGGGGGCGGCAGG + Intergenic
1132372368 15:101307691-101307713 CATCGCAGCCCGGCAGCCGCTGG - Intronic
1132585876 16:705584-705606 CGTCGGCGCGCGGGGGCCGCCGG + Exonic
1132902919 16:2268143-2268165 CATCGCTGCGCGCCGGGCGGCGG - Intronic
1135942696 16:26836309-26836331 CCTCACTGCCCGGGGTCCGCGGG + Intergenic
1135976105 16:27109822-27109844 CATCGCCGCTGGGGGGCAGCAGG - Intergenic
1142429643 16:90019270-90019292 AAGCGCTGCGCGGGGGTCTCGGG + Intronic
1142474273 17:180411-180433 CCTCTCTGCCCGGGGGCCGCGGG + Intronic
1142682800 17:1560409-1560431 CATCCCTGGGCGGGGGACGGGGG - Intronic
1145031319 17:19507367-19507389 GATGGCGGCGCGGGGGACGCGGG - Intronic
1146322662 17:31859015-31859037 CCGGGCTGGGCGGGGGCCGCGGG - Intronic
1148957452 17:51365504-51365526 CAGCTGTGTGCGGGGGCCGCCGG - Intergenic
1152175052 17:78782022-78782044 CCTCGCGGGGCGGGGGTCGCAGG - Intronic
1154196642 18:12271872-12271894 CCTCGCCGGGCGGGGGCTGCGGG - Intronic
1155654481 18:28177647-28177669 CTCCGCTGCGTGGGGGCCGAGGG + Intergenic
1156275846 18:35581901-35581923 CAGCGCTGCGCGCGGGTCGGAGG + Intronic
1160198543 18:76777352-76777374 CCTCACTGCCTGGGGGCCGCTGG - Intergenic
1160374363 18:78400260-78400282 CGGCGCTGCACGGGGCCCGCAGG + Intergenic
1160792561 19:929406-929428 CACTGCAGCGTGGGGGCCGCGGG - Exonic
1161333745 19:3700184-3700206 GGTCGCTGCGGGGGCGCCGCCGG - Intronic
1161605149 19:5210768-5210790 CATCGCGACACAGGGGCCGCTGG - Exonic
1161973330 19:7595983-7596005 CATGGCGGCGCCGGGGCTGCGGG - Exonic
1163658527 19:18562367-18562389 GATGGCTTGGCGGGGGCCGCAGG + Intronic
1166047517 19:40238159-40238181 CATCACTGCGCTGGGGCAGGGGG - Intronic
1168336617 19:55600638-55600660 CTTCGCAGCTCGGGGGCCGATGG + Intronic
925436666 2:3844277-3844299 CATGGCTGCGTGGGGGACTCTGG - Intronic
927156466 2:20224234-20224256 CAGGGCTGCGTGGGGGGCGCGGG - Intronic
936671525 2:114662341-114662363 CACCGCTGCGCGGGGAGCTCCGG + Intronic
940177971 2:150900351-150900373 CATGGCTGGGTGGGGGCCTCAGG + Intergenic
941087520 2:161134905-161134927 CATCACTGCCCGGGGGCAGCAGG - Intergenic
941917807 2:170823583-170823605 CATCCCTGTGCTGGGGCAGCCGG + Intronic
942890530 2:180981153-180981175 GAGGGCCGCGCGGGGGCCGCGGG - Intronic
946354862 2:219178293-219178315 CAGGGCTGCGCGGCCGCCGCCGG - Exonic
947551954 2:231052808-231052830 CAGCGCAGCGCTGTGGCCGCGGG - Intergenic
948457779 2:238114886-238114908 CAGCTCAGCCCGGGGGCCGCCGG - Intronic
948963214 2:241356257-241356279 GCGCGCTGCGCGGGGGCTGCCGG + Exonic
1171486903 20:25491767-25491789 CCTCGCTGTGAGGGGGCAGCTGG - Intronic
1172110471 20:32541714-32541736 CAGCTCAGCGCGGGTGCCGCGGG - Intronic
1176156983 20:63626915-63626937 CCTCGCCGCGGGGGGGCCGCGGG + Intronic
1177905397 21:26966807-26966829 CAGCGCAGCGCGGGGGCGGGAGG - Intergenic
1178840606 21:36135173-36135195 CATGGCTGAGCGGGGAGCGCGGG - Exonic
1179732307 21:43374674-43374696 CTTGGGTGGGCGGGGGCCGCAGG - Intergenic
1179913810 21:44463775-44463797 CAGCGCTCCGCCGAGGCCGCTGG + Intergenic
1179967999 21:44817966-44817988 CATGGCTGCGCGAGCGGCGCGGG + Exonic
1183299407 22:37051648-37051670 CCTGGCTCCGCGTGGGCCGCGGG - Intergenic
1184584244 22:45436835-45436857 CCTCACTGCGCGGGGCCGGCAGG - Intergenic
1184680366 22:46069819-46069841 CAACGCTGGGCTGGGGCAGCCGG - Intronic
1184906265 22:47488560-47488582 CCTCACTGCGCGGGGCCGGCAGG + Intergenic
1185280369 22:49967272-49967294 CAAGGCTGGACGGGGGCCGCTGG - Intergenic
1185322369 22:50207682-50207704 CATCCCTGCCCTGGGCCCGCTGG + Intronic
949559331 3:5187786-5187808 CATGGTCGCGCGGGCGCCGCGGG - Exonic
950632636 3:14293318-14293340 CCTCACTGCCCGGGGCCCGCGGG - Intergenic
953484943 3:43286485-43286507 CAGCGCTGGGGCGGGGCCGCGGG - Intergenic
961637714 3:128343448-128343470 CTTAGCTCCGGGGGGGCCGCTGG + Intronic
962770877 3:138609080-138609102 CATCTCTGGGCGGCGGCGGCGGG + Intronic
966696332 3:182793713-182793735 CCGCGGGGCGCGGGGGCCGCGGG - Exonic
968199380 3:196739738-196739760 CAGGCCCGCGCGGGGGCCGCTGG - Intergenic
972337429 4:38119890-38119912 CATCTCTGCCCTGGGGCCCCAGG + Intronic
977065074 4:92304302-92304324 CATCGCTGCGCGGGGGCCGCGGG - Intergenic
980115210 4:128672770-128672792 CCTCACTGCCCGGGGGCAGCGGG - Intergenic
985536838 5:469682-469704 CATGGCTGCCCATGGGCCGCAGG + Intronic
985629902 5:1008902-1008924 CCACGCCGCGCGGGGGCCGGGGG - Exonic
988726955 5:33936061-33936083 CCTCGCGGCGCGGGCGCGGCTGG + Intergenic
989102285 5:37834610-37834632 CCTCCCCGCGGGGGGGCCGCCGG - Intronic
992105646 5:73447626-73447648 CTGCGCGGCGCGGGAGCCGCAGG - Exonic
998130273 5:139648298-139648320 GAACGCTGCCCGGGGGCTGCCGG - Exonic
1001773361 5:174311831-174311853 CACCGCAGAGCGGGGGCTGCTGG + Intergenic
1002372879 5:178768884-178768906 CATGGCTGCCTGGGGGCTGCAGG + Intergenic
1003482566 6:6546714-6546736 TCTGGCTGCGCGGTGGCCGCGGG - Intergenic
1003586031 6:7389965-7389987 CATCGCAGAGCGGCGGCCTCCGG + Exonic
1006136700 6:31900381-31900403 CATGGCTGCCCGGGGGGCGGGGG - Exonic
1006351113 6:33521760-33521782 CCTCGCTGCCCGGGGCCAGCCGG + Intergenic
1006511663 6:34524897-34524919 CATAGCTGCCAGGGGGCTGCTGG - Intronic
1007406081 6:41637176-41637198 CATCGCTGGGACGTGGCCGCGGG + Intronic
1014240733 6:119015432-119015454 CCTCACTGCCCGGGGCCCGCAGG - Intronic
1017891781 6:158644870-158644892 CATCCCTGGGCGGGGCCCGTGGG + Intergenic
1019396770 7:824349-824371 CATCCCTGCTTGAGGGCCGCTGG + Intronic
1019455498 7:1124858-1124880 ACCCGCTGCGCGGGAGCCGCAGG + Intronic
1019944278 7:4314190-4314212 CCTCACTGCCCGGGGCCCGCAGG + Intergenic
1019965762 7:4497182-4497204 CCTCACTGCCCGGGGCCCGCAGG + Intergenic
1020100972 7:5394333-5394355 CATCGCTGAGCTGGGGCTGGTGG - Intronic
1020238598 7:6374897-6374919 TGTCGCGGGGCGGGGGCCGCGGG + Intronic
1021510378 7:21427524-21427546 GCTCCCTGCGCGGGGGCAGCGGG + Intergenic
1025089700 7:56051920-56051942 CAGCGCAGCGCGGGGTCTGCAGG + Exonic
1030304144 7:108002585-108002607 AAACCCTGAGCGGGGGCCGCGGG + Intronic
1032382941 7:131503235-131503257 CATCGCTGATGGGGGGCCCCGGG + Intronic
1034446163 7:151115273-151115295 CAGTGCTGCGCGGCGGGCGCGGG + Intronic
1035626989 8:1077902-1077924 CAGGGCTGTGCGGCGGCCGCTGG - Intergenic
1036195252 8:6708426-6708448 CATCGATCCGGGAGGGCCGCGGG + Exonic
1037811385 8:22089155-22089177 CCTCGTCGCGCCGGGGCCGCCGG + Intronic
1042367297 8:67952189-67952211 AATCCCGGCGCGGGGGGCGCGGG - Exonic
1049173945 8:141179967-141179989 CATTGCTGCCCGGAGGCCCCTGG - Intronic
1049683253 8:143929169-143929191 GAGCGCAGCGTGGGGGCCGCAGG + Exonic
1051780553 9:20684328-20684350 CACCCCTGCTCGGGAGCCGCCGG + Intronic
1054255025 9:62802503-62802525 CATCGCCACCCCGGGGCCGCGGG + Intergenic
1058508828 9:105694487-105694509 CCGCGCTTCGCGGGAGCCGCAGG - Intergenic
1059411003 9:114132385-114132407 CATCACTGCGTGGGGGCCAGGGG - Intergenic
1060468663 9:123929928-123929950 CAGCGCCGAGCGGGGCCCGCGGG - Exonic
1062269222 9:135701067-135701089 CACCCCTGGGCGGGTGCCGCCGG - Intergenic
1190789626 X:53686597-53686619 AATGGCTCCGCGGGGCCCGCAGG + Intronic
1191250555 X:58258152-58258174 CAGCCCTGCGCAGGGGCTGCTGG - Intergenic