ID: 977067233

View in Genome Browser
Species Human (GRCh38)
Location 4:92333365-92333387
Sequence GTTTCCAGAAAGGCACCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977067233_977067239 29 Left 977067233 4:92333365-92333387 CCCACAGGTGCCTTTCTGGAAAC 0: 1
1: 0
2: 6
3: 20
4: 170
Right 977067239 4:92333417-92333439 AGATCTCAGAAATGCCTTTAGGG 0: 1
1: 6
2: 95
3: 400
4: 766
977067233_977067238 28 Left 977067233 4:92333365-92333387 CCCACAGGTGCCTTTCTGGAAAC 0: 1
1: 0
2: 6
3: 20
4: 170
Right 977067238 4:92333416-92333438 AAGATCTCAGAAATGCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977067233 Original CRISPR GTTTCCAGAAAGGCACCTGT GGG (reversed) Intronic
903505543 1:23832597-23832619 ATTTGCAGAAAGGCAGATGTTGG - Intronic
904377421 1:30090533-30090555 GCTTCCAGAGAGGCCCCTGGGGG + Intergenic
907699615 1:56772310-56772332 GTTTCCAAAAAGGCATCTTTAGG + Intronic
907932727 1:59015541-59015563 GTTTCAAGAGAGGCCCATGTGGG + Intergenic
910318041 1:85911423-85911445 TTTTCCTAAAAGGGACCTGTTGG - Exonic
911388416 1:97206541-97206563 GTTACAAGAAAGGATCCTGTGGG - Intronic
919926929 1:202196321-202196343 TCTACCAGAAAGGCACCTGAAGG + Intronic
920223279 1:204420052-204420074 GTTTTCAGAAAGGGAACTGCAGG - Intergenic
921446464 1:215252675-215252697 CTTTCCAGACAGGCTTCTGTTGG + Intergenic
921619236 1:217308249-217308271 GTTTCCAGAGAGGTGCCAGTGGG + Intergenic
923044644 1:230346746-230346768 GACTACAGGAAGGCACCTGTAGG - Intronic
1063106076 10:2993612-2993634 GCTTCCAGAAAGGCAGCTTTGGG + Intergenic
1063672362 10:8109547-8109569 GGTTCCTGAAAGGCACCTTCTGG - Intergenic
1067226829 10:44382230-44382252 AACTCCAGAAAGGCACCTCTGGG + Intronic
1070657506 10:78281510-78281532 GTTTCCCAAATGGCACTTGTAGG + Intergenic
1071342246 10:84659751-84659773 GTTGCCAGAATGGCACGTTTTGG - Intergenic
1071895280 10:90059831-90059853 GTTTTCAGAAGGGCACCTGCTGG + Intergenic
1072250745 10:93580667-93580689 GTTTCCAAAAAGGCATTTCTTGG - Intronic
1072267427 10:93744031-93744053 GTTCCCAGAAAGGGGCCTTTAGG - Intergenic
1074018459 10:109559738-109559760 GTTTTCAGAGAGGCACCCATGGG - Intergenic
1074315780 10:112360476-112360498 TTTTCCAGGAATGCACCGGTAGG - Intergenic
1074619910 10:115107912-115107934 GTTTCCAGAAAGGCATCTATGGG - Intronic
1076006162 10:126949315-126949337 GATTCCAGGAAGGCACTTCTTGG + Intronic
1078399181 11:11009217-11009239 ATTTACACAAAGGCTCCTGTGGG + Intergenic
1082790919 11:57346321-57346343 ATGTCTAGAAAGGCACCTGAGGG + Intronic
1084114146 11:67031995-67032017 GTTGACAGAATGTCACCTGTGGG - Intronic
1084488205 11:69463416-69463438 GTTTCCAGAAAAGCTTCTGTGGG - Intergenic
1088098944 11:106132603-106132625 AGGACCAGAAAGGCACCTGTAGG - Intergenic
1088232777 11:107689852-107689874 GTTTCCAGAAAGGCTCATTCCGG + Intergenic
1090047444 11:123348562-123348584 GTTTCCAGAAAAGCAGAGGTTGG - Intergenic
1090204520 11:124877139-124877161 GCTTCCAGAAAGGAACCCGTGGG - Exonic
1090634894 11:128684958-128684980 GTTTCTAGAAAAGCAGCTGGGGG + Intergenic
1091076610 11:132624193-132624215 GTTTAAATAAAGGCAACTGTAGG + Intronic
1091165453 11:133471897-133471919 GTTTCCAGAAATCCTCCTGCTGG - Intronic
1093038669 12:14355563-14355585 GTTTCCAGTGAGACACCTGAGGG + Intergenic
1095544281 12:43346222-43346244 GTGTCATGAAAGGAACCTGTTGG - Intergenic
1095816913 12:46433117-46433139 ATTTCCAGAAATGCAAGTGTGGG + Intergenic
1096484905 12:51973220-51973242 CTTTTCTGAAAGGCAACTGTGGG + Intronic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1100902565 12:99259364-99259386 CTTTTCAGAAAGGCAGCTGCCGG - Intronic
1101081516 12:101190409-101190431 GTTTCCATAAAGACAACTGATGG + Intronic
1101674398 12:106904391-106904413 GTTCCCTGAAAGGCACTTGAAGG + Intergenic
1101758963 12:107643607-107643629 CTTTCCTGAATGGCAGCTGTTGG + Intronic
1103851024 12:123933822-123933844 GTTACAAGAAAGCCACCTGATGG - Intronic
1105419030 13:20236466-20236488 GTTCCCAGAGAGGTGCCTGTGGG - Intergenic
1105635144 13:22209256-22209278 GTTTCCAAAATGGCAGCTGCAGG - Intergenic
1107366121 13:39678598-39678620 TTTTCCAGAAAGGAATCTTTTGG + Intronic
1109512897 13:63402898-63402920 ATTTCAAGGAAGGAACCTGTTGG - Intergenic
1111019830 13:82434917-82434939 GTTTCAAGAGAGGGACCTGGTGG - Intergenic
1112382854 13:98909342-98909364 GTTTCCAGAAAGTCTGCTGTAGG + Intronic
1112458731 13:99584508-99584530 CTTTCCAGGAAGCCTCCTGTTGG + Intergenic
1114983618 14:28196737-28196759 CTTTTCAGAAAGGCAAGTGTAGG + Intergenic
1120637745 14:86973022-86973044 GTTTCCAAAAGAGCATCTGTTGG - Intergenic
1120681910 14:87490093-87490115 GTGTCCAGGAAGGGACCTGCTGG - Intergenic
1121121884 14:91381143-91381165 GCTCCCAGAGAAGCACCTGTGGG + Intronic
1122019328 14:98823605-98823627 TTTTCAAGAAAGGCACTTATGGG + Intergenic
1128254460 15:66186486-66186508 GTTTCCAGAAAGGAGACTGTAGG + Intronic
1128359101 15:66948264-66948286 GTATCCAGAGAGGCGCCTGTGGG + Intergenic
1128626106 15:69205971-69205993 GTTGGTAGTAAGGCACCTGTTGG - Intronic
1134331415 16:13254625-13254647 CTTTCCAGAAAGGGGCCTCTTGG + Intergenic
1135031780 16:19044497-19044519 GTTTTAAGAAAGGCAGCTTTGGG + Intronic
1135494801 16:22942017-22942039 AGTTCCAGGAAGGTACCTGTGGG + Intergenic
1138514266 16:57527253-57527275 GTTACCAGAAAGCCACCTAGGGG - Intronic
1138740435 16:59302880-59302902 GCTTCCAGAAAGGCAGACGTGGG + Intergenic
1139163596 16:64539892-64539914 GTTTCCAGAGAGACACCTGTGGG + Intergenic
1139262049 16:65603714-65603736 GTTTACTGAAACCCACCTGTAGG + Intergenic
1139850899 16:69951197-69951219 GTGTCCAGACAGCCTCCTGTTGG - Intronic
1139879881 16:70174109-70174131 GTGTCCAGACAGCCTCCTGTTGG - Intronic
1140372638 16:74421439-74421461 GTGTCCAGACAGCCTCCTGTTGG + Intronic
1141056299 16:80817785-80817807 GTTTTAAGAGAGGCACCTTTGGG - Intergenic
1141857506 16:86693923-86693945 CTTTCTAGAACAGCACCTGTAGG - Intergenic
1144774698 17:17779418-17779440 GTTTCAAGACAGGGAACTGTGGG - Intronic
1146674352 17:34762985-34763007 TCTCCCAGAAAGGCAGCTGTGGG - Intergenic
1150331939 17:64301369-64301391 ATTTCCAGAACGGTAGCTGTGGG - Intergenic
1150685620 17:67318511-67318533 GTATCCAGAAAAGCACATCTGGG - Intergenic
1151210781 17:72542377-72542399 GTTTCCAGAAAGCCAGCTCCTGG - Intergenic
1152325276 17:79632406-79632428 GTTTCCAGAGGGACCCCTGTTGG + Intergenic
1154156611 18:11948789-11948811 GTTTCCAGAAATAAACCTTTGGG + Intergenic
1155557215 18:27033140-27033162 TATTCCAGAAAGGCAGCTGTTGG + Intronic
1155986579 18:32236679-32236701 GTTTCCAGAAAGACAGCTTGAGG + Intronic
1159943366 18:74425888-74425910 GTTTTCAGCAAGGCAAATGTGGG - Intergenic
1161023455 19:2023015-2023037 GCTTCCAAGAAGGCAGCTGTTGG + Intronic
1163415378 19:17183326-17183348 GGTTCCAGAAGGGCCTCTGTGGG + Intronic
927246351 2:20959814-20959836 GTTTGGAGAAAGGCAAGTGTGGG + Intergenic
928820744 2:35357509-35357531 TTTTCCAGAAAATCACCAGTTGG + Intergenic
929245537 2:39698057-39698079 GTTTCCAAAAGAGCACATGTTGG + Intronic
930557756 2:52921266-52921288 ATTTCCAGAAAGGCACATTTTGG + Intergenic
935421210 2:102871160-102871182 TTTTGGAGAAAGGCACCTGCAGG + Intergenic
936644153 2:114349331-114349353 GTTTCCAGAGAGACATCTGCAGG - Intergenic
939383076 2:141461231-141461253 GTTTCCCGAAAGGCAAGTGAAGG + Intronic
939702364 2:145409203-145409225 AATTCCATAAAGGCACCTCTTGG + Intergenic
940663288 2:156574377-156574399 GTTTCCAAAAAGGAACTTATTGG + Intronic
941588404 2:167388410-167388432 GTCTCCAGGAAGGCTCCTGGAGG + Intergenic
943509371 2:188804693-188804715 GCTTGCAGAAAGCCTCCTGTGGG + Intergenic
944957866 2:204833533-204833555 GTTTCCTGGAAGGGACCTGGTGG + Intronic
945022376 2:205586432-205586454 GTATCCAGAAAGGGTTCTGTTGG + Intronic
946788303 2:223272384-223272406 GTGTCGAGAAAGGGACCTGGTGG - Intergenic
947415860 2:229894943-229894965 CTTTAGAGAAAGGCACCTTTAGG + Intronic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1171030683 20:21673862-21673884 GAATCCAGAAAGGCCACTGTGGG + Intergenic
1174418220 20:50381882-50381904 GATTCCAGCAAGGTGCCTGTAGG + Intergenic
1175278841 20:57789029-57789051 GATTCGAGGAAGGCACCTGTGGG + Intergenic
1175686023 20:61029443-61029465 GTGTCCAGGGAGGCACCTGGTGG - Intergenic
1176153671 20:63607133-63607155 GTTTCTAGAAATGGACTTGTGGG - Intronic
1178894305 21:36546002-36546024 GTTTCCTGAAAGGCAGCTGTTGG - Intronic
1181137767 22:20781035-20781057 GTATCCTGAAAAGCACTTGTAGG - Intronic
1184345152 22:43908715-43908737 GTCTCCAGAAAGGCTCCAGGTGG - Intergenic
1185118361 22:48950789-48950811 ATGGCCAGAAAGGCACCTGCAGG - Intergenic
950101011 3:10356839-10356861 GTTTGCAGGAAAGCACGTGTGGG + Intronic
953021539 3:39117510-39117532 GTGGCCAGAAAGGCACTTGGGGG - Intronic
953351870 3:42222054-42222076 GTTTCCAGAAGGGCAGCAGAGGG - Intronic
955096944 3:55808110-55808132 GTTTCCAGGAGGACACCAGTAGG - Intronic
955392882 3:58534130-58534152 GTCTCCAGAAAGGGCTCTGTTGG + Exonic
955703267 3:61703268-61703290 TTTTCCAGAAAGGCATCAGTCGG - Intronic
955871283 3:63441400-63441422 GTTTCCAGCAATGCACCTGTAGG - Intronic
956892967 3:73630421-73630443 GCTTCCAGAAAAGCTCCTGAAGG - Intergenic
958196311 3:90245885-90245907 GTTTCCAGAGGGGCACCTGAAGG - Intergenic
958419503 3:93914527-93914549 GTTTCCAGAGGGGCACCTGCAGG - Intronic
958555728 3:95673648-95673670 GTTTTCAGAGAGGAGCCTGTGGG - Intergenic
963728365 3:148946957-148946979 GTTTCCTGAACGTCACCCGTGGG + Intergenic
968669648 4:1842217-1842239 CTTTCCAGAAAGTCACTTGTTGG - Intronic
969154896 4:5201842-5201864 GTTTCGACAAAGGGACCTGGTGG - Intronic
977067233 4:92333365-92333387 GTTTCCAGAAAGGCACCTGTGGG - Intronic
977789069 4:101076529-101076551 GTTTCCATAAAGACTTCTGTTGG - Intronic
978230399 4:106390753-106390775 GTTTCCAGAAAGACAGATGTGGG - Intergenic
982371074 4:154634067-154634089 GTGTCCAGGAAGGGACCTGGTGG + Intronic
982549514 4:156780070-156780092 CTTTCCACAATGGCATCTGTGGG + Intronic
983092395 4:163519863-163519885 GTTTCCTGAAAGATTCCTGTGGG + Exonic
985713100 5:1441475-1441497 GGGACCAGGAAGGCACCTGTGGG + Exonic
986681710 5:10239262-10239284 GTTTGCAGAAAAGCAACTGGGGG - Exonic
987599996 5:20055617-20055639 GTTTCCTGAAAGCCAGTTGTTGG - Intronic
987754885 5:22087868-22087890 GTTTCCAGAAAGCCACCCACTGG + Intronic
988166468 5:27596368-27596390 GTTTCGAGAGAGGGACCTGGTGG - Intergenic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
990557877 5:56952705-56952727 GTTTCCACGAAGGGACCTGCAGG + Intronic
992128330 5:73665813-73665835 TCCTCCAGAAAAGCACCTGTTGG - Intronic
993095855 5:83476813-83476835 GTTTCCTGAAACACACCTCTGGG + Intronic
993868590 5:93223584-93223606 GTTGCCTCAAAGTCACCTGTTGG - Intergenic
995346039 5:111119065-111119087 GTTGCCAGAAAGTCTCCAGTAGG - Exonic
995938456 5:117548030-117548052 CTTCCAAGAAAGGCACCTGAAGG + Intergenic
996915106 5:128703107-128703129 GTTTCCAGAGAGGCTCCTGTGGG + Intronic
997369732 5:133350848-133350870 ATTTCCAGAAAGCCACCTTAAGG - Intronic
999057711 5:148597718-148597740 GTTTCCAAAAAACCACATGTTGG - Intronic
999824919 5:155264792-155264814 GTGACCAACAAGGCACCTGTGGG + Intergenic
1000036886 5:157455591-157455613 GTTTTCAGACTGGCACCTGTAGG - Intronic
1003361092 6:5425874-5425896 GTTTCAAGAAAAGACCCTGTGGG - Intronic
1004215491 6:13700231-13700253 ATTTCCAGAAAGGCACTGGCTGG - Intronic
1004573279 6:16868720-16868742 GATTCCAGATAGTCACATGTAGG - Intergenic
1005178660 6:23077970-23077992 GATTGCAGCAAGGCAACTGTGGG + Intergenic
1005375191 6:25174772-25174794 GTTTCCAGAAAACCACCTTCAGG - Intergenic
1007963806 6:45985420-45985442 TTTTACAGAAAGGTACCTATGGG - Intronic
1008167827 6:48162027-48162049 GTTGCCAGAATCGCACCTTTAGG + Intergenic
1008511440 6:52279390-52279412 CTTTCCAGGAAGGCAACGGTAGG + Exonic
1014559319 6:122871751-122871773 GTTTCCAGAGAGGCACCCAAGGG + Intergenic
1015417429 6:132965251-132965273 ATTACCTGAAAGGCACATGTGGG + Intergenic
1016003630 6:139067389-139067411 GTTCCCAGACAGGCACTTGATGG + Intergenic
1017823217 6:158063790-158063812 GTTTTCAGAAAGGCACTTTGCGG + Exonic
1018717888 6:166548275-166548297 GTGTTCACAAATGCACCTGTAGG + Intronic
1026204703 7:68246774-68246796 TATTCCTGGAAGGCACCTGTAGG + Intergenic
1030780075 7:113589789-113589811 GTTTCCTGTTAGGCATCTGTAGG + Intergenic
1032104664 7:129017008-129017030 CCTTCCAGGAAGGCATCTGTAGG + Exonic
1034258163 7:149735749-149735771 GTTTCCAGACAGTCACCTCGGGG - Intergenic
1035386686 7:158477805-158477827 TTTTCCAGAAAGGCAGCAGGGGG - Intronic
1037416857 8:18660506-18660528 ATTTCCTGAAATCCACCTGTGGG - Intronic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1041624917 8:60014653-60014675 TTTTCCAGAGAGGGACCTGGTGG - Intergenic
1042702303 8:71628743-71628765 GTTACCAGAAAAGCATATGTGGG - Intergenic
1042709707 8:71703329-71703351 GTTTCCAGGAAAGCACCTCAGGG - Intergenic
1043181170 8:77088222-77088244 GTTTGCAGAAATGCAAATGTAGG - Intergenic
1044256494 8:90069613-90069635 GGTCACAGAAAGGCACATGTGGG + Intronic
1044459940 8:92432267-92432289 TTTTCCAGAAAGGCTCGTATTGG + Intergenic
1045176475 8:99730659-99730681 CTCTCCTGAAAGGTACCTGTAGG + Intronic
1045711037 8:104984303-104984325 GTATCCAGAAAGGCTACTCTGGG + Intronic
1046611892 8:116435019-116435041 GTTTCCAGTGTGGCACCTCTGGG + Intergenic
1048624634 8:136171768-136171790 GTTGTCAGAAAGGCTCCAGTTGG + Intergenic
1048807232 8:138252096-138252118 GGTACCAGAAAGAAACCTGTCGG + Intronic
1051218856 9:14827766-14827788 GTTTCAAGGGAGGGACCTGTGGG + Intronic
1055072299 9:72179202-72179224 GATTTCAGAAAGGCATCTGATGG - Intronic
1057291306 9:93809123-93809145 TTTTCCAGAAAAGCAGCTGAAGG - Intergenic
1058103282 9:100939943-100939965 GTTTCCAGCAAGGTAACTTTGGG + Intergenic
1061766680 9:132885974-132885996 ATACCCACAAAGGCACCTGTAGG - Intronic
1062285851 9:135772181-135772203 GTTTCCTGGAAGCCACCTGGGGG - Intronic
1185868095 X:3640372-3640394 TTTTCCAGATAGGAACCTGTAGG - Intronic
1186006130 X:5074530-5074552 GTATCCAGAGAGGAACCTGATGG + Intergenic
1187712213 X:22065993-22066015 GTTTCCTCAAAGGCACCAGCTGG - Intronic
1188773150 X:34179377-34179399 GTGTCCAGAAAGACCTCTGTTGG - Intergenic
1189270780 X:39750376-39750398 GCTTCCATAAAGGCACCACTGGG + Intergenic
1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG + Intergenic
1195210997 X:102652083-102652105 GATTCCGGAAAGGGGCCTGTGGG + Intronic
1195217148 X:102713035-102713057 GATTCCCGAAAGGGGCCTGTGGG + Intronic
1195221273 X:102746624-102746646 GATTCCGGAAAGGGGCCTGTGGG + Intronic
1195703149 X:107719994-107720016 GCTTCCAGAATGGAACGTGTAGG + Intronic
1196014120 X:110919358-110919380 GGTTCAAGAAAGCCACCTCTGGG - Intergenic
1197058354 X:122147733-122147755 GTTTCCAGAGAGGCACCCATTGG + Intergenic
1200796146 Y:7342977-7342999 TTTTCCAGATAGGAACCTGTAGG + Intergenic
1201894203 Y:18976424-18976446 GTTTCCAAAAATGCTACTGTGGG + Intergenic