ID: 977069987

View in Genome Browser
Species Human (GRCh38)
Location 4:92373413-92373435
Sequence GGGCTGACACAGCTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977069987_977069992 2 Left 977069987 4:92373413-92373435 CCATGGCCCAGCTGTGTCAGCCC 0: 1
1: 0
2: 5
3: 39
4: 376
Right 977069992 4:92373438-92373460 CTTCTAACAATGTTGTAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 100
977069987_977069993 16 Left 977069987 4:92373413-92373435 CCATGGCCCAGCTGTGTCAGCCC 0: 1
1: 0
2: 5
3: 39
4: 376
Right 977069993 4:92373452-92373474 GTAGCCTGGCTGATAGTGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977069987 Original CRISPR GGGCTGACACAGCTGGGCCA TGG (reversed) Intronic
901227375 1:7621607-7621629 GGGCTGCCACTGCTGGGCAGAGG - Intronic
901611790 1:10504559-10504581 TGGCAGACACAGCTGGGTAAAGG - Intronic
901859494 1:12064815-12064837 GGGCTTGCAGAGCTGGGACAGGG - Intronic
902754995 1:18543079-18543101 GAGCTGACACGATTGGGCCAAGG - Intergenic
903366248 1:22807052-22807074 GGCCTGGCACATGTGGGCCATGG + Intronic
903831412 1:26177529-26177551 GAGCTGGCAGAGCTGGGCCATGG + Exonic
904001702 1:27342444-27342466 GGCCTGCCTGAGCTGGGCCATGG - Intronic
904868306 1:33600162-33600184 GGTTTTACACAGCTGGCCCAAGG + Intronic
905796162 1:40817883-40817905 AGTCTGAGACAGCTGGGACAGGG + Intronic
906062119 1:42955758-42955780 GGGGTGAGACATCTGGGGCAGGG + Intronic
906237775 1:44222176-44222198 GGCTTGGCACTGCTGGGCCAGGG + Intronic
906687514 1:47772064-47772086 GGGAGGCCTCAGCTGGGCCAGGG + Intronic
907453107 1:54559893-54559915 GGGCTGACCTGGCTGAGCCAAGG + Intronic
907461088 1:54606146-54606168 GGCCTGAGTCAGCTGGGCCAGGG - Intronic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
911994695 1:104750371-104750393 TGGCTTACAAAGCTGGTCCAGGG - Intergenic
912248902 1:107990777-107990799 GCGGTGACTCAGCTGGCCCATGG - Intergenic
913211023 1:116582399-116582421 GGGCTCACACAACTGGGGAAGGG - Intronic
915589177 1:156860964-156860986 TGGCTGGCACAGCTGGGCTGCGG + Exonic
915874021 1:159593163-159593185 GGGTTCACACAGCTGTGCCTGGG + Intergenic
916294259 1:163199710-163199732 GTGCTGAAACCACTGGGCCATGG - Intronic
917665974 1:177226214-177226236 GGGGTGAAGTAGCTGGGCCAAGG + Intronic
917848878 1:179043198-179043220 GGGCTGAGACAGCAGGGGCCTGG + Intronic
920527161 1:206675498-206675520 AGGCTGTCAAAGCTGGTCCAGGG + Intronic
920674661 1:208030678-208030700 GAGCCGACACAGATGGGCCCAGG - Intronic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
924179381 1:241424875-241424897 GGGCTGTCAGTGCTGGGGCACGG - Intergenic
1062764061 10:48082-48104 GGCCGGAAACAACTGGGCCAAGG - Exonic
1063034458 10:2271717-2271739 GAGTAGACACAGCTTGGCCAAGG + Intergenic
1063391259 10:5651172-5651194 GGGCTGGCCCAGCTGGGCTCTGG - Intronic
1063601708 10:7487677-7487699 GGACTGACACAGCTGTGCACTGG + Intergenic
1064010214 10:11729737-11729759 GGGCAGACGCAGCTGTGCCCAGG - Intergenic
1067275358 10:44828767-44828789 GGGCTAACACCGCTGGGCCTGGG + Intergenic
1068971627 10:62964075-62964097 CTGCTGACAGAGCTTGGCCAAGG - Intergenic
1072205642 10:93203045-93203067 GGAATAACACAGCTGGGGCAAGG + Intergenic
1073014039 10:100384080-100384102 GGTCTGGCACAGATGGGACATGG - Intergenic
1073062756 10:100742139-100742161 GGGCAGAAAACGCTGGGCCAGGG + Intronic
1073188185 10:101630001-101630023 GGGCTGACACACTTTGGCAAGGG + Intronic
1075703845 10:124486736-124486758 AAACTGATACAGCTGGGCCAGGG + Intronic
1076523621 10:131096304-131096326 GGGTGGACACAGCTAAGCCATGG + Intronic
1076880140 10:133235957-133235979 GGGCTGAGACACCGGGGCCCTGG + Intergenic
1077097206 11:804125-804147 GCTCTGAGGCAGCTGGGCCAGGG + Exonic
1077186555 11:1238091-1238113 GGCCTGACAAAGCTGAGCCCAGG + Intronic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1078375080 11:10786534-10786556 TGGCTGAGACACCTGGGCCCTGG - Intergenic
1079699103 11:23520981-23521003 TGACTGACACAGCTCAGCCAGGG + Intergenic
1082175082 11:49049476-49049498 AGGCTGATACCGCTGGCCCAGGG - Intergenic
1082812686 11:57488126-57488148 AGACTGAGACAGCGGGGCCAGGG + Intronic
1083204601 11:61140646-61140668 AGACTGACACAGTTGGTCCAGGG + Intronic
1083879280 11:65540179-65540201 GGGCCGTCACAGCTCGGCCCGGG + Intronic
1083959836 11:66008521-66008543 GTGATGACACAGCAGGCCCAGGG + Intergenic
1084086713 11:66858307-66858329 GAGCTGACCGAGCTGGGCGAAGG - Exonic
1084117807 11:67052179-67052201 GGGGAGACACAGCTGGGCTGAGG + Intergenic
1084273636 11:68041303-68041325 GGGCAGAAAGAGCTGGACCAGGG - Exonic
1084432974 11:69121864-69121886 GGGCTGAGACAGATGGGCAGGGG - Intergenic
1084949531 11:72657128-72657150 GGCCTGACCCAGCTGGGCCAGGG - Intronic
1084964711 11:72738600-72738622 GTGCTGGGACAGCTGGGCCCAGG - Intronic
1085299475 11:75449915-75449937 GTCCTCCCACAGCTGGGCCACGG + Exonic
1085315453 11:75542200-75542222 GGGCTCACAGAGCAGGGCCCAGG - Intergenic
1089572229 11:119418435-119418457 GGGCTGGCACTGATGGGCGAGGG + Exonic
1090184467 11:124727470-124727492 GGGCTGACGTGGCTGGACCAAGG - Intergenic
1091226957 11:133963246-133963268 GGGCATACTCAGGTGGGCCAGGG - Intergenic
1091279424 11:134373657-134373679 GGGCCGAGTCAGCTGGGCCGGGG - Intronic
1091834389 12:3575496-3575518 TTGCTGTCACGGCTGGGCCATGG + Intronic
1092168230 12:6356135-6356157 GAGCTCAAACAGCTGGCCCAAGG + Intronic
1092778772 12:11966354-11966376 GTGCTGATACAGCTGGTCCAGGG - Intergenic
1093372310 12:18379713-18379735 GGGCTCCCCCAGCTTGGCCAGGG + Intronic
1094435791 12:30419391-30419413 GGGCTCACACATCTGGGCAGCGG - Intergenic
1095103040 12:38202730-38202752 GGCCGGAAACAACTGGGCCAAGG + Intergenic
1096148038 12:49292959-49292981 GGGCTGCCACAGCAGGGCTCTGG - Intergenic
1097597501 12:61652605-61652627 GGGTTGACAGAGCAGGCCCAGGG + Intergenic
1098823970 12:75269994-75270016 AGGCTGAAACAGGTTGGCCAAGG - Intergenic
1099957896 12:89368926-89368948 AGGCTGAGACAGCAGGCCCACGG + Intergenic
1101143588 12:101820609-101820631 TGGTTGATACAGCTGGGGCATGG - Intronic
1102555747 12:113725350-113725372 GACCTGACACTGCTGGGCAAGGG + Intergenic
1102695974 12:114799826-114799848 GGGCTGGCAGAGCAGGCCCAGGG - Intergenic
1102751768 12:115300795-115300817 GTGCTGATGCTGCTGGGCCAAGG + Intergenic
1103023471 12:117555112-117555134 GGGCTGGCACTGCTGGGTGAGGG - Intronic
1104635530 12:130436003-130436025 AGGCTGACCCAGCAGGGCCGAGG + Intronic
1104946463 12:132416972-132416994 GGGCTGGCAGGGGTGGGCCAAGG - Intergenic
1105840299 13:24248225-24248247 GCTCTGAAAAAGCTGGGCCATGG - Intronic
1106487004 13:30180995-30181017 GGGCTGGTACAGATGGGCCCAGG + Intergenic
1106549918 13:30762204-30762226 GGGCTGATGCTGCTGGTCCACGG + Intronic
1107618182 13:42194949-42194971 TGGCTGCCACAGCTGGACCAGGG - Exonic
1108322841 13:49304033-49304055 GGGGTGACACAGCTAGGCCCTGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110722470 13:78779808-78779830 GGGCTGTCAGAGCTGGCACATGG - Intergenic
1111012259 13:82327820-82327842 GGTTTGACAAAGCTGGGCCTGGG - Intergenic
1113263766 13:108593918-108593940 TGGCAGACACAGCTGGCCCATGG + Intergenic
1114477473 14:23007073-23007095 GGGCTGACTCAGCTAGGCAGAGG + Intronic
1114735820 14:25042835-25042857 GAGCTGACACAGTTGGCCCTTGG - Intronic
1116486316 14:45453147-45453169 AGGCTGTCACTGCTGGGACAGGG - Intergenic
1116961539 14:50973012-50973034 GGGCTGCCGCAGCTGCGCCTGGG - Intergenic
1118847691 14:69560097-69560119 GAGCTGGCACAGATGGGTCAAGG - Intergenic
1119618092 14:76111923-76111945 GGGTGGCCACAGCTGGGCCCTGG - Intergenic
1121092747 14:91194241-91194263 TGGCTGACATAGCTTGCCCAAGG + Intronic
1121469272 14:94139308-94139330 ATGCTGACACTGCTGGTCCATGG + Intergenic
1122103500 14:99432829-99432851 TGGCTGTCACACCTGGGCCTGGG - Intronic
1122796847 14:104210313-104210335 GAGCAGACAGAGCCGGGCCACGG - Intergenic
1123012875 14:105357729-105357751 GGGCTCAGGCAGCTGTGCCATGG + Intronic
1202895165 14_GL000194v1_random:2516-2538 GGCCTCACACAGCCAGGCCATGG - Intergenic
1123783054 15:23645799-23645821 GGGCTGCTCCAGCTGGACCAAGG + Exonic
1124291346 15:28456066-28456088 GTGCTGGACCAGCTGGGCCAGGG - Intergenic
1125972259 15:43921511-43921533 GAGCTGTCACAGCTGATCCATGG + Intronic
1126957576 15:53951404-53951426 GGGCTGACCCAGGTTTGCCAGGG + Intergenic
1127752472 15:62059998-62060020 GGGCGGGGACAGCAGGGCCAGGG + Intronic
1128999357 15:72319871-72319893 GGGCTGACAGGGCGGGGACATGG - Exonic
1129245843 15:74278195-74278217 GGGCAGACACAGCTGAGCCTTGG + Intronic
1129699214 15:77757918-77757940 GGCCTGACACAGCCGAGGCAGGG - Intronic
1129926590 15:79369783-79369805 GGCCTGGCACAGCAGGGCCTTGG - Intronic
1131306261 15:91246554-91246576 AGACTGAGACATCTGGGCCATGG - Intronic
1132543416 16:521923-521945 GGGGTGACACCGCTGTGCCTGGG - Exonic
1132715025 16:1285912-1285934 GCGCTGACAGACCTGGGCCGTGG + Intergenic
1133116393 16:3580175-3580197 GGGCTGACAGCGCTGGGCAGAGG - Intergenic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1134216689 16:12321868-12321890 GGGATATCACAGCTGTGCCAGGG + Intronic
1135113815 16:19709768-19709790 GGGCTGCAACAGATGGGCGAGGG - Intronic
1136707432 16:32201605-32201627 GTGCTGGATCAGCTGGGCCAGGG + Intergenic
1136760479 16:32727812-32727834 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1136807624 16:33142574-33142596 GTGCTGGGTCAGCTGGGCCAGGG + Intergenic
1137911043 16:52378902-52378924 GTGATGACTCAGCTGGGACAGGG - Intergenic
1138023732 16:53506032-53506054 GGGTGGACAGAGCTTGGCCATGG + Intergenic
1138301021 16:55929971-55929993 GGGGAGCCACTGCTGGGCCAAGG - Intronic
1138341079 16:56289426-56289448 GGACTGGCACACATGGGCCACGG + Intronic
1141499340 16:84432851-84432873 GTGCTAACACAGGTGGTCCAGGG + Intronic
1141506626 16:84482411-84482433 GGGCAGTGACAGCTGGGCCAGGG - Intronic
1142199275 16:88753368-88753390 GGGCTGAGACAGGAGGGCCCTGG + Intronic
1142440591 16:90095144-90095166 GGCCGGAAACAACTGGGCCAAGG + Intergenic
1203062632 16_KI270728v1_random:988127-988149 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1142806320 17:2372887-2372909 GGGCTCACCCAGCTGGGCCACGG + Intronic
1143038923 17:4017908-4017930 GGGCTGCCACCGCTGAGCCAGGG + Exonic
1143485379 17:7251331-7251353 GGGCTGGCGGAGCTGGGCCGCGG - Exonic
1143882032 17:10037002-10037024 GGGTTCACACAGCTGGGGCCGGG - Intronic
1144784715 17:17825180-17825202 AGCCTGAGACAGCAGGGCCAGGG + Intronic
1145207876 17:20994364-20994386 GGCCTTACACAGCAAGGCCAGGG + Intergenic
1147139851 17:38454648-38454670 GGGCTGACAGGGCTGGGCTGGGG + Intronic
1147429915 17:40364623-40364645 GGGGTGTCAGAGCTGAGCCAGGG + Exonic
1147585437 17:41651632-41651654 GAGCTGGGACAGCTGGGCGAAGG + Intergenic
1148235520 17:45965938-45965960 GGGCTGCCAGAGCAGGTCCATGG + Intronic
1148483971 17:47978661-47978683 GAGCTGAGACACCTGGGACAAGG + Intronic
1148835680 17:50464604-50464626 GGGCTGGCAGAGTTGGGGCATGG + Exonic
1149996846 17:61410166-61410188 AGACTGACACAGCTGGACCCCGG - Intergenic
1150255302 17:63740036-63740058 GGGATTACAGAGGTGGGCCACGG + Intronic
1150797242 17:68248128-68248150 GTGCTGTCAGAGCTGGGCCGGGG + Exonic
1150816324 17:68395003-68395025 GGGTTGACACGGCAGGGTCAGGG + Intronic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151973090 17:77469095-77469117 GGCCTGGCACAGCGGGGCCCAGG + Intronic
1152235466 17:79136183-79136205 GGGCTGTCAGGGCTGAGCCAGGG - Intronic
1152239284 17:79153120-79153142 GGGCAGACACAGCTGGACCAGGG - Intronic
1152331814 17:79677841-79677863 GGGTTGGCAGAGCTGGGGCAGGG + Intergenic
1152422718 17:80202785-80202807 TGGTTGTCACAGCTGGGGCATGG - Intronic
1152424687 17:80212511-80212533 GGGGTGACACAGAAGTGCCAAGG - Intronic
1152497828 17:80686779-80686801 GGACTCACACAGCTGGGCGAGGG - Intronic
1152956968 18:48415-48437 GGCCGGAAACAACTGGGCCAAGG - Exonic
1154105374 18:11518224-11518246 GTGCAGACACAGTAGGGCCATGG + Intergenic
1154500236 18:14992409-14992431 GGCCTCACACAGCCAGGCCATGG - Intergenic
1157403819 18:47407410-47407432 GGGATGACAGAACTGGGTCAGGG - Intergenic
1159093766 18:63878617-63878639 GGACTGACACAGTTAGACCATGG + Intronic
1160527066 18:79544376-79544398 GAGCTGAGCCAGCTGGACCAAGG + Intergenic
1160753276 19:745291-745313 GAAGGGACACAGCTGGGCCAAGG - Intronic
1160932880 19:1578831-1578853 GGGTTTACACAGCTGAGCCCCGG - Intronic
1161063984 19:2228640-2228662 GGGCTGGCACAGCTGCCCCCAGG - Intronic
1161493955 19:4577551-4577573 AGGCTGGCTTAGCTGGGCCATGG + Intergenic
1161789322 19:6349541-6349563 GGGCAGACAGAACTGGGCAAAGG + Intergenic
1162110973 19:8399593-8399615 GGGCTGTCCCAGCTGGGGCAAGG - Intronic
1162402971 19:10457347-10457369 GGGCTTCCAGAGCTGAGCCAAGG - Intronic
1162589088 19:11578962-11578984 GGGCTGACCCAGGTGAGCCCCGG + Exonic
1162777349 19:12987879-12987901 GGGCTGAAACATCTGGGCTCTGG - Intergenic
1163603530 19:18262250-18262272 GGGCTGAAATGGCTGTGCCAGGG + Intronic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165374847 19:35434472-35434494 GAGCTGTCAGAGATGGGCCAGGG - Intergenic
1165899562 19:39162770-39162792 GGGCTGACTCTGCTGGGCCTGGG - Intronic
1166126938 19:40720594-40720616 GAGCAGACAAAGCTGGGCCATGG - Intronic
1166998201 19:46729888-46729910 GAACTCACGCAGCTGGGCCAGGG + Intronic
1167156325 19:47741446-47741468 GGGGAGCCACAGCAGGGCCATGG - Exonic
1167941087 19:52946461-52946483 GGGCTTTCTCAGCTGGGCCGTGG - Intronic
1168413671 19:56155684-56155706 GAGGTGACACAGCTGGTTCAGGG + Intronic
926378802 2:12263253-12263275 GGGCAGTCAGAGCTGTGCCAGGG - Intergenic
926977003 2:18525414-18525436 GAGCTGACACAGCCCAGCCATGG + Intergenic
927361514 2:22240186-22240208 GAACTCACACAGCTGTGCCATGG - Intergenic
927849041 2:26487460-26487482 AGGCTTAAACAGCTGGTCCAGGG - Intronic
928089616 2:28366176-28366198 GGCCTGACACCGTTGGCCCAAGG - Intergenic
929864857 2:45709248-45709270 GGGCAGACCCAGCCAGGCCAAGG + Intronic
930027180 2:47036144-47036166 GGGCTGACACAACTGGCCTCCGG - Intronic
931774362 2:65527649-65527671 GGGCTGACACAGTAGTGCCCAGG - Intergenic
932335113 2:70926363-70926385 GGGCTGACAAAGGTGGGCAGAGG - Intronic
932490012 2:72114469-72114491 GGGAGGACACTGGTGGGCCATGG - Intergenic
932522256 2:72427067-72427089 GGGTTGGCAGAGCTGGGCCTGGG + Intronic
933196593 2:79397054-79397076 ATGCTGACACTGCTGGTCCAGGG + Intronic
934123149 2:88859638-88859660 GGGCAGACACAGGGTGGCCACGG + Intergenic
934950834 2:98574260-98574282 AGGCTGTCACAGCCTGGCCAGGG - Intronic
935175112 2:100642482-100642504 GGGCTCCCAAAGCTGGGCCAAGG + Intergenic
935962198 2:108436861-108436883 GGGCCGACAGAGGTGGGCCCAGG - Intergenic
937078708 2:119125412-119125434 GGGCTGGCAGAGCTGGGGCCTGG - Intergenic
938380228 2:130832290-130832312 GGACTGGCACAGTTGGGTCAAGG - Intergenic
938604426 2:132877572-132877594 AGGCTGACGCTGCTGGTCCAGGG + Intronic
939405252 2:141747062-141747084 AGCCTGACTCAGCTGTGCCAAGG - Intronic
940136294 2:150439833-150439855 GCACTGACACAGCTGGGGGATGG - Intergenic
940430449 2:153584036-153584058 GGGCTGTGACAGCTGGGGTAGGG + Intergenic
940855740 2:158727424-158727446 GACATGACAGAGCTGGGCCAGGG - Intergenic
945418192 2:209600710-209600732 GGGCTGACAGAGCCAGGACACGG + Intronic
946404841 2:219486754-219486776 GGGCTGGCAGGGCTGGGCCCGGG + Intronic
947818845 2:233057059-233057081 GGGCTGACATGGCAGGGCCAAGG - Intergenic
948639279 2:239364178-239364200 GGGCTGGCATTGCTGGGGCATGG - Intronic
948756606 2:240163061-240163083 GGGCTGACACAGCTATGGGAGGG + Intergenic
1168956695 20:1839023-1839045 GAGCTGACAGAGCTGGACCGTGG + Intergenic
1169345109 20:4823161-4823183 GGGCTGACCCAGCCGGGGTAGGG + Intronic
1170096720 20:12653314-12653336 ATGCTGACACTGCTGGCCCAAGG + Intergenic
1171964557 20:31519555-31519577 ATGCTGACACTGCTGGCCCAGGG - Intronic
1172930009 20:38579805-38579827 GGGCTGGGAGAGCTGGGGCATGG - Intergenic
1173451842 20:43171773-43171795 ATGCTGACACTGCTGGTCCAGGG + Intronic
1173944872 20:46942598-46942620 GGGATCACACAGCTGGGCTCTGG + Intronic
1173974217 20:47174985-47175007 GGGCTGACTCAGGTGAGACAGGG + Intronic
1174110569 20:48195195-48195217 GGGCTGCCACAGCTGTGTCCTGG + Intergenic
1174444797 20:50583271-50583293 GGTCTGACGCAGCAGGCCCATGG - Exonic
1175196203 20:57244864-57244886 GGGCAGACACAGCTGGTTTAAGG + Intronic
1175441662 20:58996502-58996524 TGGCTGAGACAGCTGGAGCAAGG + Intronic
1175680851 20:60987565-60987587 GGGCTGACAAAGGTGTGCCCAGG + Intergenic
1175862460 20:62157586-62157608 GGCCTCCCAGAGCTGGGCCAGGG - Intronic
1176024648 20:62979559-62979581 GGGCGCAAACAGCTGAGCCAGGG + Intergenic
1176044875 20:63087386-63087408 GGGTTGACCCTGCTGGGCCCAGG + Intergenic
1176614868 21:9018503-9018525 GGCCTCACACAGCCAGGCCATGG - Intergenic
1179219749 21:39395741-39395763 TGTTTGACACAGCTGGGCCTAGG + Intronic
1179354053 21:40642151-40642173 GTACTGGCACAGCTGGGCCCTGG + Intronic
1179631391 21:42680596-42680618 TGCCTGACAGGGCTGGGCCATGG + Intronic
1180017408 21:45096393-45096415 GGGCCGGCACAGCTGGTGCAGGG - Intronic
1180138488 21:45876526-45876548 GGGCTTACACAGCCTGGCCTCGG - Intronic
1180149301 21:45939630-45939652 GTGCAGACACCGCTGGGCCATGG + Intronic
1180933052 22:19606278-19606300 GGGCCGACACAGAAGGGCCAGGG + Intergenic
1180945130 22:19688519-19688541 GGGCAGGCACGGCCGGGCCACGG - Intergenic
1181449751 22:23011634-23011656 GGGTTGTCACAGCTGGGCCAGGG + Intergenic
1181579712 22:23821237-23821259 GGGTGGACACAGCTGGCCCAGGG + Intronic
1181646213 22:24232924-24232946 GGGCTGGAACAGCTGCGCCCAGG + Exonic
1182321103 22:29479139-29479161 GGGAGGACACAGCTTGTCCAAGG + Intergenic
1182357936 22:29730629-29730651 GGGATGGCACAGCTGGGGCATGG - Exonic
1182758207 22:32698473-32698495 GGGCTTCCACATCTGGGGCAAGG - Intronic
1183256747 22:36767253-36767275 GGGCTCCCCCAGCTGGGCCCAGG - Intronic
1183317046 22:37142550-37142572 GGACCCACACAGCTGGCCCAAGG + Intronic
1183704499 22:39468611-39468633 GGGCTCACACAAGTGGCCCATGG - Intronic
1184380313 22:44141145-44141167 GGGCTGGGCCAGCTTGGCCATGG + Intronic
1184782843 22:46657717-46657739 GGGCTGTCCCCGCTGGCCCAGGG + Intronic
1185002812 22:48256624-48256646 GGGATGACGCAGCGTGGCCAAGG - Intergenic
1185136049 22:49073281-49073303 GGACCATCACAGCTGGGCCAGGG + Intergenic
1185404070 22:50635880-50635902 CGGGGGGCACAGCTGGGCCAGGG - Intergenic
950124083 3:10500983-10501005 GGGCTTACACAGCTTTTCCAAGG + Intronic
950202883 3:11057311-11057333 CAGCTGACCCAGCTGGGTCAGGG - Intergenic
950891408 3:16408078-16408100 GGCCAGAGACAGCTGGGACAGGG - Intronic
951233009 3:20201317-20201339 TGGCACACACAGCTGGACCATGG + Intergenic
952898654 3:38095662-38095684 GGCCTGTCTCAGCTGGGCCTGGG - Intronic
953810585 3:46109233-46109255 GGCCTGAGCCAGCTGGCCCAGGG + Intergenic
954610854 3:51943853-51943875 GGGGGGACACAGCTGGGCCCTGG - Intronic
954751817 3:52818166-52818188 GGGCTGGGACAGCCGGGGCACGG + Exonic
955213117 3:56960610-56960632 GGGCTGACACAGAAGAGCCAGGG + Intronic
956719924 3:72108738-72108760 GTGCTGGCACTGCTGGTCCATGG + Intergenic
959582137 3:107992975-107992997 GGGCTGTCCCAGCTGGGCATGGG + Intergenic
960115073 3:113885240-113885262 GGGCTGGCGGAGCTGGGCCGTGG + Intronic
961545641 3:127630927-127630949 GGGCAGTTACAGCTGGGCCTGGG - Intronic
961662595 3:128477560-128477582 GGGCTGGGGCAGCTGGGACAAGG + Intergenic
963254795 3:143134174-143134196 GGGCTGATACTGCTGGTCCAAGG - Intergenic
963346686 3:144103385-144103407 ATGCTGACACTGCTGGTCCAGGG + Intergenic
965310124 3:167116554-167116576 GAGGAGGCACAGCTGGGCCAGGG - Intergenic
965442365 3:168730133-168730155 AGGCATACACATCTGGGCCATGG + Intergenic
966120073 3:176511157-176511179 GGCTTGACAAAGCTGGGCCCTGG + Intergenic
966402850 3:179564052-179564074 ATGCTGACACTGCTGGTCCATGG - Intronic
967881420 3:194304480-194304502 GTGCTCACACAGCGGGGCGATGG - Intergenic
967882829 3:194313975-194313997 AGGCTGTCACAGCTGGGGCAGGG - Intergenic
968357344 3:198119732-198119754 GGCCGGAAACAACTGGGCCAAGG + Intergenic
968445698 4:651081-651103 GGGCTGTCACAGGCGGGGCAGGG + Intronic
968494491 4:907782-907804 TGGATGGCACAGCTGTGCCAGGG - Intronic
968750252 4:2385206-2385228 GGACAGACAGACCTGGGCCATGG + Intronic
969516209 4:7649496-7649518 GGTGTGGCCCAGCTGGGCCATGG + Intronic
970575072 4:17419204-17419226 GGGCAGTCACACCTGGCCCATGG - Intergenic
971464476 4:26940945-26940967 GTGCTGATACTGCTGGTCCAGGG + Intronic
973271536 4:48267852-48267874 GAGCTGGAACAGCTGGGGCAGGG + Intronic
973793057 4:54395626-54395648 GGCCTGAGACAGCTGAGACAAGG - Intergenic
975614580 4:76234096-76234118 GGGCTGAGACACATGGCCCAAGG - Intronic
977069987 4:92373413-92373435 GGGCTGACACAGCTGGGCCATGG - Intronic
977152409 4:93529368-93529390 GTGCTGATGCAGCTGGACCAGGG - Intronic
977288803 4:95141068-95141090 GGCCTCACACAGCTAGGCTATGG - Intronic
977336555 4:95707060-95707082 GGGGTGACACAAATGGGCCTGGG - Intergenic
978810250 4:112841759-112841781 GTGCGGACACAGCTAGGCGAGGG - Intronic
980574468 4:134666826-134666848 GGGCAGCCGCAGCTGGGCCCAGG + Intergenic
983889460 4:173015962-173015984 GAGCTGAAGCAGCTGGGACACGG - Intronic
985441192 4:189983518-189983540 GGCCGGAAACAACTGGGCCAAGG - Intergenic
985709504 5:1420276-1420298 GAGGAGACTCAGCTGGGCCATGG - Intronic
986788895 5:11141668-11141690 GTGCAGACACAGCTGGCCTAAGG - Intronic
989246892 5:39264999-39265021 AGGCTGACGCTGCTGGTCCAGGG - Intronic
990250001 5:53903800-53903822 GGGCTGAAACAAGTGTGCCAAGG + Intronic
991583314 5:68178697-68178719 GGGATGACTCAGCTGGGGCAAGG - Intergenic
991986187 5:72289099-72289121 GGTCAGGAACAGCTGGGCCAAGG - Intronic
992056581 5:72996844-72996866 GGGCTGGCGGAGCTGTGCCACGG + Intronic
992135589 5:73740768-73740790 TGTCAGACACACCTGGGCCATGG - Intronic
992839050 5:80668838-80668860 GGGCAGCCACAGCTGTGCCCAGG + Intronic
994517913 5:100794038-100794060 AGGCTGAAGCAGCAGGGCCATGG - Intergenic
996453730 5:123656404-123656426 GAGCTGGAACAGCTGGGACACGG + Intergenic
996749064 5:126871126-126871148 GAGGTCACACAGCTGGGCGAGGG - Intronic
997202457 5:132019676-132019698 GAGCTGACATAGCTTGCCCAAGG + Intergenic
998167283 5:139851541-139851563 GGGCTGGCACCACTGGCCCAAGG - Intronic
998365586 5:141628681-141628703 GGGCTGAAACAGCTGGGTTGTGG - Intronic
998390626 5:141785028-141785050 CGGCTGACTGAGCTGGGCCCTGG + Intergenic
998795012 5:145809366-145809388 GGTCGGGCATAGCTGGGCCATGG - Intronic
1001325800 5:170722935-170722957 GGGCTAACAGAGCTGGTCCCTGG + Intronic
1001837844 5:174846934-174846956 AGGCTGACACCGCTGCTCCATGG - Intergenic
1002079551 5:176729152-176729174 GAGCAGGCAAAGCTGGGCCAAGG - Intergenic
1002167921 5:177359521-177359543 AGGCTGACACAGAAGGGGCAGGG - Intronic
1002368323 5:178730242-178730264 GGGCGGACGCAGCCGGGCCCCGG - Intronic
1002783547 6:384494-384516 GGTCTGAGAGTGCTGGGCCAAGG + Intergenic
1003242563 6:4357579-4357601 GGGCGAGCACAGCTGGACCAGGG + Intergenic
1005106581 6:22230222-22230244 GGGAAGAAAAAGCTGGGCCAGGG - Intergenic
1005355639 6:24980795-24980817 GGCCTGATACAGCTGGGCTCTGG + Intronic
1006604370 6:35245431-35245453 TGGCTTGCAGAGCTGGGCCAGGG + Intronic
1006915624 6:37592005-37592027 GGGCACACACAGCTGGGCCGGGG + Intergenic
1007412273 6:41671863-41671885 GGGATGGCATTGCTGGGCCATGG - Intergenic
1008568755 6:52794668-52794690 TGGCTGACATGGCTGTGCCAGGG - Intronic
1008684215 6:53906207-53906229 GGGCTCACACAGCTGGGAGTTGG + Intronic
1011693050 6:89887559-89887581 GGGCTGCCACAGCGGGGCTAAGG - Intergenic
1011714321 6:90088625-90088647 AGGCTGATGCAGCTGGTCCAGGG - Intronic
1011911799 6:92449736-92449758 GGGCTGACACAGTTAGGACAGGG + Intergenic
1012169608 6:96002219-96002241 GAGCTGTCACAGCTTGGCCTGGG - Intergenic
1013184324 6:107744887-107744909 GGGCAGAGACACCTGGGACAGGG + Intronic
1017755624 6:157526768-157526790 GGACTGACACACGTGCGCCAGGG + Intronic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1018482667 6:164207393-164207415 GGGCTGAAGCTGCTGGCCCAGGG + Intergenic
1019053333 6:169201318-169201340 GTGCTGCCACAGCTGGGCACGGG + Intergenic
1019172787 6:170143627-170143649 GGGCTCTCACAGCTGAGCCACGG - Intergenic
1019434114 7:1012944-1012966 GGGATGACACAGGCGGGCCCCGG + Intronic
1020761143 7:12269447-12269469 GGGCTGCCACAACTGTGCCTGGG - Intergenic
1022410744 7:30136490-30136512 GGGGAGACAAAGCTGGGCCGTGG + Intronic
1022536942 7:31104168-31104190 GGGCTCTCACTCCTGGGCCAGGG - Intronic
1022942426 7:35253722-35253744 GAGCAGTCACAGCGGGGCCAGGG + Exonic
1023844989 7:44115545-44115567 GGGCAGCAACAGCAGGGCCAAGG - Intronic
1024786334 7:52911593-52911615 GGGCAGCCACAGCTGTGCCTGGG + Intergenic
1025199934 7:56955866-56955888 GGGCTGACACAGAACGGCCCAGG - Intergenic
1025672012 7:63621066-63621088 GGGCTGACACAGAACGGCCCAGG + Intergenic
1026287184 7:68973619-68973641 GGGCAGACACAGTTGGGAAAGGG - Intergenic
1026509767 7:71018324-71018346 GAGCTGCCACACCTGGCCCAGGG - Intergenic
1027540511 7:79458201-79458223 GGACTGGGACAGCTGAGCCAGGG + Intergenic
1028204582 7:88001931-88001953 GAGATGACACAGCATGGCCATGG - Intronic
1029112929 7:98222796-98222818 GGGGTGACAGAGGTGGGCCAAGG - Intronic
1029737686 7:102473712-102473734 GAGCTGGAACAGCTGGGGCAAGG + Intronic
1032018657 7:128394716-128394738 GGGCTGAGTCAGATGGCCCAGGG + Intronic
1034255315 7:149721539-149721561 AGTCTGACACAGCAGGGACAGGG + Intronic
1034256744 7:149728924-149728946 GGGCTGGCACGGCCGGGACAAGG - Intronic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034424437 7:151007196-151007218 CGGCTGCTGCAGCTGGGCCAGGG + Exonic
1034856545 7:154553925-154553947 GTGCTGACACAGCTGAGTCCTGG + Intronic
1035245538 7:157560196-157560218 AGGCTGACCCTGCTGAGCCAGGG - Intronic
1035398666 7:158551154-158551176 GTGCTGGCACAGCTGGGCTCTGG + Intronic
1035781101 8:2229004-2229026 GGCCTGACACACGTGGCCCACGG - Intergenic
1035914664 8:3606177-3606199 GGGAGGACAGAGATGGGCCAAGG + Intronic
1037809659 8:22080084-22080106 GGCCTTCCACAGCTGGGGCAGGG - Intronic
1038429479 8:27488423-27488445 GGGCTTACCCAGCAGGGCTATGG - Intergenic
1041454816 8:58047270-58047292 AGGCTGAGACTCCTGGGCCAAGG - Intronic
1045243728 8:100424783-100424805 AGTCTGACACAACTGTGCCAGGG - Intergenic
1045438695 8:102189126-102189148 CTTCTGACTCAGCTGGGCCAGGG + Intergenic
1047643637 8:126846949-126846971 GGCCTAGAACAGCTGGGCCAAGG + Intergenic
1049025686 8:139987265-139987287 GGGTTGAAATAGCTGGGCAAAGG + Intronic
1049252597 8:141597224-141597246 GGCCTGACCCAGCTGGGCAGGGG - Intergenic
1049616652 8:143578470-143578492 GGGCTGAAACAGCTGGACCCGGG + Exonic
1049687912 8:143946349-143946371 GAGCTGATTCAGCTGGGCCAAGG - Intronic
1049769933 8:144375065-144375087 GGGGTCACACAGCTGGGCTGGGG - Intronic
1049932620 9:471211-471233 GAGCTGGCGAAGCTGGGCCAAGG + Intronic
1049957757 9:709304-709326 CGGCTGAGAAAGCTGGGGCATGG - Intronic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1053647316 9:40131066-40131088 GGCCTCACACAGCCGGGCCATGG + Intergenic
1053758410 9:41332777-41332799 GGCCTCACACAGCTGGGCCATGG - Intergenic
1054328313 9:63729022-63729044 GGACTCACACAGCCAGGCCATGG + Intergenic
1054537263 9:66245104-66245126 GGCCTCACACAGCCGGGCCATGG - Intergenic
1054766705 9:69048162-69048184 AGGCTGAGACAGCTGGGCATGGG - Intronic
1055404695 9:75962371-75962393 GTGCAGATCCAGCTGGGCCAGGG + Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1057077900 9:92148835-92148857 GGGTGGACACAGCTAAGCCATGG + Intergenic
1057279507 9:93699732-93699754 TGGGTGACAAAGCAGGGCCAGGG + Intergenic
1057575259 9:96237379-96237401 GAGCTGCAACAGCTGGCCCATGG - Intronic
1057807391 9:98229335-98229357 ATGCTGACACAGCTTGTCCAGGG + Intronic
1058670842 9:107359334-107359356 GGGCTGGCACAGGTGGCCCTGGG + Intergenic
1058687056 9:107488754-107488776 GGGCATACACAGCTGAGCCAAGG + Intronic
1059244301 9:112836595-112836617 AGGCTGACACAGCAGGACAAAGG - Intronic
1059439979 9:114301375-114301397 GGGCTCCCAGAGTTGGGCCATGG + Intronic
1059443698 9:114325187-114325209 GGGCTGCCCAAGTTGGGCCATGG - Intronic
1059444899 9:114331964-114331986 GGGCTGCCCAAGTTGGGCCATGG - Intronic
1060633667 9:125182782-125182804 TGGTTGTCACAGCTGGGTCAGGG - Intronic
1060664135 9:125422956-125422978 CGATTGACACAGCTGGCCCATGG + Intergenic
1060732962 9:126049620-126049642 AGGCTGCCACAGCTGAGCCCAGG - Intergenic
1060927867 9:127467878-127467900 GGGCTGGCACAGGGTGGCCATGG - Intronic
1061045703 9:128163772-128163794 GGGCTGGCCCAGGTAGGCCAAGG - Exonic
1061368918 9:130187086-130187108 TGGCTGACCCAGCAGGGCAAGGG + Intronic
1061610881 9:131744858-131744880 GGCCAGACCCAACTGGGCCAGGG - Intergenic
1061662304 9:132138265-132138287 GAGGGGACAGAGCTGGGCCAGGG + Intergenic
1062190461 9:135245382-135245404 GGGCAGACTGAGCTGGGACAAGG - Intergenic
1062302964 9:135885921-135885943 GAACTGCCACAGCAGGGCCATGG - Intronic
1062496222 9:136833040-136833062 GGGCTGCCCCAGCTGGGTCTGGG + Intronic
1062496285 9:136833212-136833234 GGGCTGCCCCAGCTGGGTCTGGG + Intronic
1062496301 9:136833256-136833278 GGGCTGCCCCAGCTGGGTCTGGG + Intronic
1062496365 9:136833431-136833453 GGGCTGCCCCAGCTGGGTCTGGG + Intronic
1062496413 9:136833563-136833585 GGGCTGCCCCAGCTGGGTCTGGG + Intronic
1062496428 9:136833606-136833628 GGGCTGCCCCAGCTGGGTCTGGG + Intronic
1062502787 9:136858458-136858480 GGGCGGATACAGCTGGGACTGGG + Exonic
1062657800 9:137613222-137613244 AGGGTGAAACAGCTGTGCCAGGG - Intronic
1062741197 9:138176217-138176239 GGCCGGAAACAACTGGGCCAAGG + Intergenic
1185776442 X:2806450-2806472 GGCCTGACATAGATGGGCAAAGG - Intronic
1186154789 X:6713710-6713732 TGGCTGACACAACCAGGCCAGGG + Intergenic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1187506628 X:19883596-19883618 AGGCACCCACAGCTGGGCCAGGG + Intronic
1187528021 X:20071558-20071580 AGGCTGACACTACTGGTCCAGGG + Intronic
1187788676 X:22923049-22923071 TGGCTAACACAGCAAGGCCATGG + Intergenic
1187888266 X:23909003-23909025 TGGCAGTCACAGCTGGGCCTTGG - Intronic
1188101802 X:26097251-26097273 GTGCTGACACTGCTCGCCCAGGG - Intergenic
1190736056 X:53256566-53256588 GGCCTCACACAGCTGGGACAGGG - Intronic
1190736862 X:53261316-53261338 GGGCTCACACAGCTGGTCAGTGG - Intronic
1190917600 X:54821875-54821897 GGGCTGTCCCAGGTGGGCTAGGG - Intergenic
1191615109 X:63162393-63162415 AGGCTGCCACAGCTGGGACTGGG + Intergenic
1191621189 X:63216530-63216552 AGGCTGCCACAGCTGGGACTGGG - Intergenic
1192152798 X:68722492-68722514 GGCCTGACGCAGCTCAGCCAGGG - Exonic
1192222294 X:69205661-69205683 GTACTGACACTGCTGGTCCAGGG + Intergenic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1192446524 X:71215304-71215326 GGGCTGAGGGAGGTGGGCCAGGG + Intronic
1194403621 X:93467836-93467858 GGGCTGTGGCAGCTGGCCCAGGG - Intergenic
1194566396 X:95494282-95494304 TGGCTGAAGCAGCTGGGGCACGG - Intergenic
1196379438 X:115073269-115073291 GGGCTGACAGGGTTGGGGCAGGG - Intergenic
1198870602 X:141174578-141174600 GGGCTGTTACTCCTGGGCCAGGG - Intergenic