ID: 977071425

View in Genome Browser
Species Human (GRCh38)
Location 4:92393163-92393185
Sequence GTGAGAACTCACTATTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977071424_977071425 4 Left 977071424 4:92393136-92393158 CCACACACTTTAAAATGACTAGA 0: 2
1: 30
2: 350
3: 618
4: 1919
Right 977071425 4:92393163-92393185 GTGAGAACTCACTATTATATAGG 0: 1
1: 0
2: 2
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977071425 Original CRISPR GTGAGAACTCACTATTATAT AGG Intronic
909720071 1:78757003-78757025 GTGAGAACTCACTACCATCAAGG + Intergenic
910554376 1:88514679-88514701 GGGAGAAATCACTATAATACAGG + Intergenic
911533022 1:99068430-99068452 GTGACTACTCACAATTATAATGG - Intergenic
911762593 1:101633248-101633270 CTGTCAACTCCCTATTATATAGG + Intergenic
913128396 1:115814648-115814670 TTGAGTACTCACTATAATCTAGG - Intergenic
913216057 1:116621331-116621353 GTGAGAACTGACTAATACATAGG + Intronic
917510650 1:175666653-175666675 GTGGGAACTGAATATTCTATTGG - Intronic
917821262 1:178766548-178766570 GTGAGAACTAACCAATACATAGG + Intronic
918425794 1:184408514-184408536 GTGAGAAATCACTGTTCTACTGG + Intronic
918728735 1:187961361-187961383 ATTAGAAATCACTATTATGTTGG + Intergenic
918823512 1:189291299-189291321 GTGAGAACAGACTAATATAGTGG - Intergenic
918987870 1:191656970-191656992 GTGAGAACTCAGGAATACATAGG - Intergenic
919546031 1:198920075-198920097 GTGAGAACTCACTTGTCAATTGG + Intergenic
919566403 1:199194407-199194429 GTGATATTTTACTATTATATTGG - Intergenic
919721882 1:200845894-200845916 GTGAGAAGTCAGGATTATCTAGG - Intronic
922188519 1:223296964-223296986 GTGAGAACAGACTAATATAAAGG + Intronic
922277825 1:224095648-224095670 GTGAGAACAGACTAATATAGGGG - Intergenic
923344548 1:233038588-233038610 TGGAGAACTCATTATTGTATGGG + Intronic
1064524163 10:16235634-16235656 ATGAGAACAGACTAATATATAGG - Intergenic
1066315614 10:34243111-34243133 GTGAGAAAACAATTTTATATTGG + Intronic
1067894869 10:50168115-50168137 GAGGGAACACACTATTATAATGG - Intergenic
1067927757 10:50527600-50527622 GTGAGAACAGACTATGATAAGGG + Intronic
1067953965 10:50772147-50772169 GAGGGAACACACTATTATAATGG + Intronic
1067988049 10:51174469-51174491 GTGAGAACTTAAAATTAAATAGG + Intronic
1068444749 10:57106890-57106912 GTGAGAACGGACTAATAAATTGG - Intergenic
1068781918 10:60928832-60928854 GTGAGAACAGACTACTACATTGG - Intronic
1070989098 10:80715720-80715742 GGAAGAAATCAGTATTATATTGG + Intergenic
1071667090 10:87568976-87568998 GTGAGAACTGCCTAATAGATTGG + Intergenic
1072305914 10:94107066-94107088 GTCAGAACTCACTCTTCTCTAGG - Intronic
1072990501 10:100187675-100187697 GTCAGAACAGACTATTATAGTGG - Exonic
1074671293 10:115795482-115795504 GTGAGAACGGACTAATACATGGG - Intronic
1079850958 11:25533870-25533892 GTGAGAACTGACTAATACAGTGG - Intergenic
1080079071 11:28193202-28193224 GTGAGAACTGACTAATACAGAGG - Intronic
1080986077 11:37467652-37467674 GTGAGAACTCATTAGACTATGGG - Intergenic
1081882532 11:46466056-46466078 GTGAGAACTGAATATTAAACAGG + Intronic
1082782221 11:57296576-57296598 GTGAGAACAGACTAATATAATGG + Intergenic
1087086992 11:94229922-94229944 GTGAGAACAGACTAATATACTGG + Intergenic
1088368682 11:109065505-109065527 GTGAGAACTCACTGTGATTTAGG + Intergenic
1091840998 12:3620632-3620654 ATGAGAACTCTTTAGTATATGGG + Intronic
1093038275 12:14353454-14353476 ATGAGAACTCACTATCATGAGGG + Intergenic
1095781845 12:46068552-46068574 GTGAGAACAGACTAATATAGTGG + Intergenic
1097440459 12:59601802-59601824 GTGAGAGCTCTCTTTTATAAGGG + Intronic
1097762487 12:63483938-63483960 GTCCTAACTCACTATTTTATAGG - Intergenic
1098721916 12:73911159-73911181 GAGAGAACTGGCTATTGTATGGG + Intergenic
1098811569 12:75100684-75100706 GTGAGAACTTACTAGTTAATAGG + Intronic
1099290999 12:80776255-80776277 GTGAGAACAGACTAATATAATGG + Intergenic
1099386589 12:82019885-82019907 GTGAGAATGAACTAATATATTGG + Intergenic
1099513962 12:83572300-83572322 GTGAGAACGAACTATGATATGGG - Intergenic
1102177254 12:110885287-110885309 GTGAGAACTCATTCTCATCTTGG + Intronic
1104352557 12:128057510-128057532 GGGAGAATTCACTAGCATATTGG + Intergenic
1104656944 12:130580562-130580584 GTGAGAACAGACTAATACATCGG + Intronic
1105010465 12:132752809-132752831 ATGAGAACTCAGTATTAATTGGG - Intronic
1105219791 13:18314808-18314830 GTGAGAACTGACTAATACATAGG + Intergenic
1105670064 13:22603340-22603362 TCTAGAACTCACTATTATGTAGG + Intergenic
1105795370 13:23846868-23846890 GTGAGTACTCACTATGACAGTGG + Intronic
1107153731 13:37142083-37142105 GTGAGAACAGACTAATACATAGG + Intergenic
1108687312 13:52831944-52831966 GTGAGAACTGACTAATACAGTGG - Intergenic
1108754641 13:53485149-53485171 ATGAGAACTCACTATTGTTACGG - Intergenic
1110025540 13:70534017-70534039 GTGTAAACTCACTAATATATGGG - Intergenic
1110195816 13:72787407-72787429 GTGAGGACTCAGAAGTATATTGG + Intronic
1111556387 13:89886825-89886847 GTGAGCAGTCATTATGATATTGG - Intergenic
1111625972 13:90787364-90787386 GTGAGAACAGACTAATATAATGG - Intergenic
1111811143 13:93095910-93095932 GTGTATACCCACTATTATATTGG - Intergenic
1116922242 14:50591091-50591113 GTGAAAACTCAATTTTATTTAGG - Intronic
1125852357 15:42916101-42916123 AAGAGAACTGACTATTATCTTGG + Intronic
1127690240 15:61388491-61388513 GTGAGAACAGACTAATATACTGG - Intergenic
1131700759 15:94933661-94933683 GTGAGAACAGACTAATATACAGG - Intergenic
1132363394 15:101236908-101236930 GTGAGAACAGACTAATATAGAGG + Intronic
1134259611 16:12640454-12640476 GTGAGAACTTACCATAAAATGGG - Intergenic
1134810339 16:17161597-17161619 GAGAGAACTAAATATTATGTAGG - Intronic
1137952103 16:52793031-52793053 ATGAGAACGGACTAATATATGGG + Intergenic
1140632126 16:76865976-76865998 TTGAGAACTTACAAATATATAGG - Intergenic
1149726850 17:58903756-58903778 TTGAGAACTCACTAATAAAATGG + Intronic
1155062841 18:22243922-22243944 TTGAGAACTCACTACTGTTTGGG - Intergenic
1158059978 18:53328421-53328443 GTGAGAATTAACTATGATAATGG + Intronic
1159089092 18:63826530-63826552 TTGAAAACTCACTATCATCTAGG - Intergenic
1159096297 18:63906219-63906241 ATGAGAACTCACTATCATGAAGG - Intronic
1159436646 18:68426493-68426515 GTGAGAACTTATTCTTACATGGG + Intergenic
1160474550 18:79170792-79170814 TTCAGAACTCAGTATTATACTGG - Intronic
1167760467 19:51444106-51444128 GAGAGAACTCACTGGTCTATTGG + Intergenic
925246751 2:2390324-2390346 GTGAGAACTCACTATCGCAAGGG + Intergenic
925333784 2:3078193-3078215 GTGAAAAGTCACTATTTTCTTGG - Intergenic
925554575 2:5115433-5115455 GTGAGAACTGACTAATACACAGG + Intergenic
926609340 2:14930162-14930184 GTGAGAATGGACTAATATATTGG + Intergenic
927531231 2:23804504-23804526 ATGAAAACTCACTATCATTTTGG - Intronic
929221351 2:39467867-39467889 GTGAGGACTCACTACAATAGAGG + Intergenic
931382753 2:61768472-61768494 GTGAGAACTCACTACTGCAAGGG + Intergenic
934184256 2:89657709-89657731 GTGAGAACTGACTAATACATAGG - Intergenic
934294545 2:91731847-91731869 GTGAGAACTGACTAATACATAGG - Intergenic
935833098 2:107021070-107021092 ATGAGAACTCACTATCACAATGG - Intergenic
937549614 2:123071141-123071163 GTGTTAACTGACTATTTTATTGG - Intergenic
938257861 2:129874094-129874116 ATGAGAACTGACTTCTATATTGG + Intergenic
939459075 2:142476154-142476176 ATGAGAACTCACTATCACAAGGG + Intergenic
942634111 2:177983201-177983223 GTGAGAAATGACTATTATTGAGG - Intronic
944957606 2:204830222-204830244 GTGAGAATGCACTAATACATAGG + Intronic
947049607 2:226027465-226027487 GTGAGAACAGACTAATACATGGG - Intergenic
947889510 2:233604754-233604776 GTGAGTACTCACTATTACAAGGG + Intergenic
1172279002 20:33697583-33697605 GAAAGGACTCACTTTTATATTGG + Intergenic
1173542974 20:43868521-43868543 GTGAGAACAGACTAATACATAGG + Intergenic
1173872801 20:46352307-46352329 GTAAGAACTCACTACTACAGTGG - Intronic
1174089466 20:48035517-48035539 GTGAGAACGAACTAATACATGGG + Intergenic
1177469022 21:21531580-21531602 TTTAGAACTTACTATTAAATAGG - Intronic
1177502439 21:21975548-21975570 CTGAGAACTCACTATCATGAGGG + Intergenic
1178797913 21:35762588-35762610 GTCAGCCTTCACTATTATATGGG - Intronic
1179236077 21:39547612-39547634 GTGAGAACGAACTAATATATTGG - Intergenic
1179620184 21:42609304-42609326 GTGAGAAAGGACTAATATATTGG - Intergenic
1180817397 22:18799699-18799721 GTGAGAACTGACTAATACATAGG + Intergenic
1181203587 22:21234020-21234042 GTGAGAACTGACTAATACATAGG + Intergenic
1203223334 22_KI270731v1_random:61394-61416 GTGAGAACTGACTAATACATAGG - Intergenic
1203267495 22_KI270734v1_random:25426-25448 GTGAGAACTGACTAATACATAGG + Intergenic
949850853 3:8418866-8418888 GTGAGAACTCACTAACATGAGGG - Intergenic
952169229 3:30787372-30787394 GAGAGGAGTCAATATTATATAGG - Intronic
956833288 3:73074253-73074275 GTGTGAACTCACTATGAAAAGGG - Intergenic
957511372 3:81191964-81191986 GTGGCACCTCACTTTTATATCGG - Intergenic
957848906 3:85779580-85779602 GTGAGAACTCACTATCATGTGGG + Intronic
959510253 3:107202827-107202849 GTGAGAACAGACTAATACATTGG - Intergenic
960458063 3:117898345-117898367 GTGAGAACTGACTCTAATTTTGG + Intergenic
960725929 3:120670022-120670044 GTGAGAACTCACTATCATGAGGG - Intronic
962552614 3:136510569-136510591 GTGAGAACTCACTATTGGCTGGG - Intronic
965132492 3:164719495-164719517 GAGAGAACTCACTACAAAATAGG + Intergenic
970357052 4:15265430-15265452 TTGAGAACTTACTATTATGAAGG - Intergenic
970956595 4:21818608-21818630 GTGAGCACTGGCTACTATATTGG + Intronic
970977255 4:22056282-22056304 GGGAGACCTCACAATTATAGAGG - Intergenic
972026242 4:34382139-34382161 GTGAGAACTCAAAATGTTATTGG + Intergenic
973075082 4:45914911-45914933 ATTAGAACTCAGAATTATATGGG + Intergenic
973209795 4:47603142-47603164 GTGAGAACTCACTATCAAGAGGG - Intronic
973933478 4:55817671-55817693 GTAAGTACTCTCTATTATGTGGG - Intergenic
974806261 4:66883870-66883892 GTGAGAACGGACTAATATACAGG + Intergenic
975083775 4:70311860-70311882 GGTAGAAATCACTATTATTTTGG - Intergenic
976175172 4:82344373-82344395 GAGAGAAGTCACCATTATGTTGG - Intergenic
976906612 4:90244455-90244477 GTGAGAACAGACTAATACATAGG - Intronic
977071425 4:92393163-92393185 GTGAGAACTCACTATTATATAGG + Intronic
978673150 4:111275842-111275864 AAGAGAACTCTCTATAATATGGG - Intergenic
980265043 4:130504092-130504114 GTGAGATCCCACTATCAAATAGG - Intergenic
980274060 4:130625289-130625311 GGGAGACCTCACTATTACAGTGG + Intergenic
980482384 4:133403867-133403889 GTGAGAACAGACTAATAAATAGG - Intergenic
980972535 4:139580575-139580597 GTGAGAACTGACTAATACACAGG - Intronic
981502943 4:145472345-145472367 GTGAGAACAGACTAATACATGGG - Intergenic
986633755 5:9800382-9800404 GAGAGAACTCTGTATTACATTGG - Intergenic
986937989 5:12915751-12915773 GTGAGAACGAACTATTACAAAGG + Intergenic
989193198 5:38691058-38691080 ATGAGAACTCACTATCACAAGGG + Intergenic
990622526 5:57576256-57576278 GTGAGAACAGACTAATACATAGG + Intergenic
991323796 5:65406746-65406768 GTTAGAATTCAGTATAATATTGG + Intronic
992420238 5:76596730-76596752 GTGAGAACTCACTATCATCCAGG + Intronic
993595024 5:89843267-89843289 GTGATAACTCACTATCCTAAAGG + Intergenic
994382037 5:99082959-99082981 GTAAGAACTAAGTATTATTTGGG - Intergenic
997213703 5:132093727-132093749 GTGAGTACTCAATATTAGATGGG - Intergenic
999058011 5:148601902-148601924 GTGTGATCTCACTTCTATATGGG + Intronic
999344137 5:150799993-150800015 CTGAGCACTATCTATTATATTGG + Intergenic
999805055 5:155073362-155073384 ATGAGAACAGACTAATATATGGG - Intergenic
1000518576 5:162271565-162271587 GTGAGAACTCCCATGTATATGGG + Intergenic
1001345333 5:170891473-170891495 GTGAGAACCAACTAATATACAGG - Intronic
1001832884 5:174804218-174804240 GTGAGAACGGACTAATATATGGG + Intergenic
1004402091 6:15298376-15298398 GTGAGAACTCAGAATTCCATGGG + Intronic
1005184493 6:23149815-23149837 GTGAGAACAAACTAATAAATTGG - Intergenic
1009478688 6:64128120-64128142 ATCAGAAGTTACTATTATATTGG - Intronic
1010430678 6:75775182-75775204 GAGAGAACTCACTGTACTATTGG - Intronic
1010465414 6:76162504-76162526 GTGAGAATGAACTAATATATGGG - Intergenic
1011697881 6:89929522-89929544 GTGAGAAATCTCTATGAAATTGG + Exonic
1013611719 6:111802171-111802193 ATGAGAACTCACTATCATGAGGG - Intronic
1013995871 6:116307073-116307095 GTTAGAACTCTATCTTATATTGG + Intronic
1014342435 6:120227185-120227207 GTGAGAACAGACTAATACATTGG - Intergenic
1014930213 6:127326446-127326468 GTGAGAACAGACTATCACATCGG + Intronic
1018418156 6:163619523-163619545 GTGAGAACGGACTATTACAACGG - Intergenic
1022455544 7:30555280-30555302 GTGAGAACAGACTATTACAATGG - Intergenic
1022807142 7:33833781-33833803 GGGAGAAAATACTATTATATTGG + Intergenic
1026616516 7:71909845-71909867 GTGAGAACTGACTAATACACTGG - Intronic
1027570509 7:79860195-79860217 GTGAGAACTCACTCATCAATGGG - Intergenic
1027746209 7:82077575-82077597 GTTAAAAATCACTATTATTTTGG + Intronic
1028379402 7:90182075-90182097 CAGATAACTCACTATTTTATGGG + Intronic
1028947574 7:96598315-96598337 CTGAGAACTAAATATTGTATGGG + Intronic
1030969252 7:116034006-116034028 GTGAGAACTGACCATTTGATTGG - Intronic
1031798745 7:126214428-126214450 ATGAGAACTCACTATTACGAAGG - Intergenic
1032107523 7:129046636-129046658 GTGAGAACACATTAATACATGGG - Intronic
1035449363 7:158965781-158965803 GTGAGAACAGACTAATATACAGG + Intergenic
1036464554 8:8984470-8984492 GTGTGAACTCATATTTATATAGG + Intergenic
1037169020 8:15867589-15867611 GTGCGAAGTCACAATTATAAAGG + Intergenic
1038277544 8:26134436-26134458 GTGAGAAGTCCCTATTTTTTAGG - Intergenic
1043426270 8:80151319-80151341 GTGAGAACAGACTATTACAATGG + Intronic
1043782724 8:84356228-84356250 GTGAGAACTGACTAATACATAGG + Intronic
1044029142 8:87213319-87213341 GTGAGAACAGACTAATACATGGG - Intronic
1045785080 8:105911683-105911705 GTGAGAACGAACTAATACATGGG - Intergenic
1045816598 8:106283824-106283846 GTGAAACCTCACAATTATTTAGG + Intronic
1048036835 8:130685085-130685107 GTGAGAACAGACTAATATACGGG - Intergenic
1048113269 8:131491109-131491131 GTAAAAACTCACTGTCATATTGG - Intergenic
1048737958 8:137522529-137522551 GTGACAATTCACTATTAGGTAGG + Intergenic
1050276116 9:4002493-4002515 GAGAGAACTGAGTATTATGTAGG - Intronic
1050685527 9:8164206-8164228 GTGAGAACTGACTAATACACTGG + Intergenic
1050741147 9:8822387-8822409 GTCAGAACACATGATTATATTGG - Intronic
1052984428 9:34476168-34476190 GTGAGCACTCACTAATAGCTAGG - Intronic
1053328359 9:37178027-37178049 GTAAGATGTCACTATTATAGGGG + Intronic
1054698179 9:68383499-68383521 GTGACAAGTAACTATTGTATTGG + Intronic
1059826802 9:118039060-118039082 GTGAGAACAGACTAATACATAGG + Intergenic
1059848790 9:118312838-118312860 GTGAGAACAGACTATTACAGTGG - Intergenic
1186145171 X:6617533-6617555 ATGTGAACTCACTATTATGAAGG - Intergenic
1186695496 X:12026496-12026518 TTGAGAAATCATTAGTATATTGG - Intergenic
1187900145 X:24020356-24020378 TTGAAAACTCACTTTAATATGGG + Intronic
1187928426 X:24271701-24271723 GTGAGAACAGACTAATACATGGG + Intergenic
1188719397 X:33504721-33504743 GTGAGAACGGACTAATAAATTGG + Intergenic
1188879060 X:35469906-35469928 GTGAGAAGAAACTAATATATGGG - Intergenic
1189571207 X:42299741-42299763 GTGAGAAAACAGTATTATAGAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190721678 X:53153955-53153977 GTGAGAACAGACTAATACATAGG - Intergenic
1191221740 X:57996784-57996806 TTGAGCATTCATTATTATATTGG + Intergenic
1193397027 X:80997334-80997356 TTGAAAATTCAATATTATATTGG - Intergenic
1193442782 X:81564063-81564085 ATGAGAACTCACTATTGTGAGGG - Intergenic
1194242957 X:91474274-91474296 GTGAGAACTGACTAATACAGTGG - Intergenic
1194609097 X:96018685-96018707 GTGAGAAAACATTATGATATTGG + Intergenic
1197526875 X:127575207-127575229 ATGAGAACACACTAATACATTGG - Intergenic
1198146395 X:133861696-133861718 GTGAGAACTCAGTATCAACTAGG - Intronic
1198545955 X:137693082-137693104 CTGATAACTCAGTATTAAATTGG - Intergenic
1198649555 X:138846712-138846734 GTGAGAACTGACTAACACATAGG + Intronic
1198660653 X:138964806-138964828 GTGAGAACTCACTAATTTATGGG + Intronic