ID: 977071615

View in Genome Browser
Species Human (GRCh38)
Location 4:92396838-92396860
Sequence CTAGGTCAACACTACTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977071615_977071618 28 Left 977071615 4:92396838-92396860 CCAATATAGTAGTGTTGACCTAG 0: 1
1: 0
2: 0
3: 0
4: 41
Right 977071618 4:92396889-92396911 TTATTTGCTTCTCTGAAGCATGG 0: 1
1: 1
2: 0
3: 36
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977071615 Original CRISPR CTAGGTCAACACTACTATAT TGG (reversed) Intronic
904146136 1:28393322-28393344 CTATGGCAACACTAATTTATTGG + Intronic
908587359 1:65584954-65584976 CTAGGTCAGCACTACTTACTTGG + Intronic
910121268 1:83792881-83792903 CTAGGTTAACTCTAAGATATGGG + Intergenic
914870286 1:151467957-151467979 CTAGTTCAACTCTACTTCATGGG - Intergenic
915560061 1:156681855-156681877 CTGGGTCAACTGAACTATATAGG + Intergenic
919866153 1:201784533-201784555 GTAGGTAAAAACTACCATATAGG - Intronic
922691025 1:227691198-227691220 CTAGGTCTACACTACAGGATTGG + Intergenic
1077715221 11:4573911-4573933 CTAAGTGTACACAACTATATAGG - Intronic
1100097673 12:91062799-91062821 CTTGGTTAACACCACAATATTGG + Intergenic
1116034778 14:39614555-39614577 CCAGGACAACACTTCTATTTTGG - Intergenic
1116653035 14:47618246-47618268 ATAGGTCCTCACTACTTTATAGG - Intronic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1130838884 15:87678756-87678778 CTAAGTCAACTGTACTATTTTGG - Intergenic
1140211819 16:72976651-72976673 CTATGTCAACACAATTATCTGGG + Intronic
1162240252 19:9346928-9346950 CTAGTTCACTACTACTATAGAGG + Intronic
929203517 2:39263577-39263599 CTGCGTCAAGACTTCTATATGGG - Intronic
931433051 2:62224821-62224843 ATAGTTCAACACTACTGTAATGG - Intergenic
931564405 2:63600039-63600061 GTAGGTCATCACTGCTAGATAGG + Intronic
943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG + Intergenic
944581274 2:201134717-201134739 TTAGGTCAACAGTACCATGTAGG - Intronic
1181614263 22:24041566-24041588 CTAGGTCTACACCAATATAGTGG + Intronic
953941539 3:47103132-47103154 CTAGGTGAAGACTGATATATGGG + Intronic
954923695 3:54213968-54213990 CTGGGTCAACCCTACTGTAGTGG + Intronic
964527479 3:157630815-157630837 CTACTTCAACACTAATATTTTGG - Intronic
965884699 3:173430632-173430654 CTAGGTCACACCTCCTATATTGG - Intronic
967424122 3:189306661-189306683 GTAGCTCAAAATTACTATATGGG + Intronic
971115074 4:23636342-23636364 TTAGGTCAATAGTAATATATTGG + Intergenic
974406902 4:61484397-61484419 TTAGGTCATCACTGCTTTATTGG + Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
991909466 5:71547374-71547396 TTAGGGCAAGATTACTATATAGG + Intronic
992124995 5:73630849-73630871 CTTGGTCAACACTACTGGAAAGG + Intronic
1002093944 5:176819933-176819955 CTGGATCAACACTATTTTATTGG + Intronic
1004290148 6:14359311-14359333 CTTGGTCAACACTTATATAATGG + Intergenic
1024181131 7:46896380-46896402 CTAGGTAAACACTAAAATCTGGG + Intergenic
1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG + Intronic
1033832247 7:145268769-145268791 CTAAGTCAACAGCAATATATGGG - Intergenic
1044905313 8:96994725-96994747 CTAGGTCAACAGGAATAAATTGG - Intronic
1051441139 9:17084491-17084513 CTTGGTCAAGAATACTAGATTGG - Intergenic
1051689236 9:19691769-19691791 ATTGGGCAACACTAGTATATAGG + Intronic
1060388961 9:123262332-123262354 ATATGTCAACAGCACTATATTGG + Intronic
1188377381 X:29448687-29448709 CAAGTTCTATACTACTATATAGG - Intronic